ID: 959629165

View in Genome Browser
Species Human (GRCh38)
Location 3:108489088-108489110
Sequence CTGGATTAAAAAATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 941
Summary {0: 1, 1: 2, 2: 5, 3: 93, 4: 840}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959629165 Original CRISPR CTGGATTAAAAAATGGATAA AGG (reversed) Intronic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
903084296 1:20841438-20841460 CTGATTTAAAAAATTGAAAATGG + Intronic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
905123284 1:35699102-35699124 CTTCATTTGAAAATGGATAAGGG + Intergenic
905505150 1:38473092-38473114 CCTGATTAAAAAATGGGCAAAGG + Intergenic
905784293 1:40740970-40740992 GTACATTTAAAAATGGATAAGGG - Intronic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906417588 1:45632862-45632884 CCTCATTAAAAAATGGGTAAGGG + Intronic
906841444 1:49143873-49143895 CTGGATTGAAAAATGGCATATGG - Intronic
906979625 1:50615686-50615708 GCCCATTAAAAAATGGATAAAGG - Intronic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908819894 1:68074860-68074882 CCTCATTAAAAAATGGACAAAGG - Intergenic
908871998 1:68623995-68624017 CTGGATTAAAAGGTTGTTAAGGG + Intergenic
909128145 1:71701400-71701422 CTGGTTTGGAAAATGGAGAAAGG - Intronic
909661460 1:78087921-78087943 CTCCATTAAAAAGTGGACAAAGG + Intronic
909713412 1:78678218-78678240 TTGGCTAACAAAATGGATAATGG - Intergenic
910159909 1:84261546-84261568 CTGATTTAAAAAATGGGCAAAGG + Intergenic
910323930 1:85981814-85981836 CTGGGCTAAAAATTGGAGAAAGG + Intronic
910329479 1:86054464-86054486 CTTTATTAAAAAGTGGACAAAGG + Intronic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
910546191 1:88422038-88422060 CTAGATTCAAAAATGGGCAAAGG + Intergenic
910636942 1:89418614-89418636 CCAGATTAATAAATGAATAAAGG - Intergenic
910790751 1:91047483-91047505 AGGGCTTAAAAGATGGATAATGG + Intergenic
911289826 1:96043857-96043879 CTGGATGATAAAGTGGAAAATGG + Intergenic
911309277 1:96273448-96273470 CCTGATTAAAAAGTGGATGAAGG - Intergenic
911775614 1:101808028-101808050 GTTGATTAAAAAATGTATATAGG - Intronic
911806428 1:102214240-102214262 CTATATAAAAAAATGAATAAGGG + Intergenic
912103629 1:106242974-106242996 CTAGATTTAAAAATGGAACAAGG - Intergenic
912279623 1:108299079-108299101 CTTCATTAAAAAGTGGACAAAGG - Intergenic
912288603 1:108395278-108395300 CTTCATTAAAAAGTGGACAAAGG + Intronic
912473081 1:109919004-109919026 CTGCATTCCAAGATGGATAAGGG + Intronic
912646059 1:111393200-111393222 CTGGATTAAAAAAACTTTAATGG - Intergenic
913024114 1:114818456-114818478 CTAAATTTAAAAATGGGTAAAGG - Intergenic
913373473 1:118126514-118126536 TCTAATTAAAAAATGGATAAAGG - Intronic
913458078 1:119054212-119054234 CTCGATTGAAAAATGGGCAAAGG + Intronic
913623320 1:120633603-120633625 GTGGATTAACAAATGAATAAGGG + Intergenic
913941259 1:125109224-125109246 ATTTATTAAAATATGGATAATGG - Intergenic
914383392 1:147141739-147141761 CTTGACTAAAAAATGTACAAAGG - Intergenic
915112502 1:153573409-153573431 CTGGATTAATATATAGATAATGG - Intergenic
915406332 1:155662697-155662719 CTACATTAAAAAATGTACAAAGG + Intronic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
916276841 1:163003405-163003427 CACAATTAAAAAATGGGTAAAGG - Intergenic
916369896 1:164080415-164080437 CATGATTAAAAAATCGATGATGG + Intergenic
916453430 1:164944293-164944315 CCTGATTGAAAAATGGACAAAGG - Intergenic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
917069338 1:171132860-171132882 CCGGATTTTAAAATGGGTAAAGG + Intergenic
917749116 1:178038185-178038207 CTGGAAGAAAAAAAGAATAAAGG + Intergenic
918783783 1:188736812-188736834 CAGGATTTAAAAATACATAAAGG + Intergenic
918825522 1:189318881-189318903 CCTGATTAAAAAATGGGCAAAGG + Intergenic
918881783 1:190133518-190133540 ATGGATTAAAAAAAGTATGATGG + Intronic
918979041 1:191531044-191531066 CTTGATTTCATAATGGATAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919182103 1:194100089-194100111 CTGTATTAAAAAGTGGGCAAAGG - Intergenic
919221044 1:194629026-194629048 CTCCATTAAAAAACGGATTAAGG + Intergenic
919648519 1:200121591-200121613 TTGGAATAAAAAAAGGATTAAGG + Intronic
919816195 1:201441728-201441750 CCAGATTAAAAAATGGTCAAAGG + Intergenic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921675050 1:217967702-217967724 CTCCATTAAAAAGTGGACAAAGG - Intergenic
921778989 1:219138775-219138797 CTTGATTGAAAAATGAGTAAAGG + Intergenic
922084087 1:222328912-222328934 CATGATTAAAAAATGGGCAAAGG - Intergenic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
922737038 1:227991979-227992001 CTTGACTAAAAAATGGGCAAAGG + Intergenic
923177571 1:231481958-231481980 CTTGATTAAAAAATGGGCAAAGG - Intergenic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923428857 1:233900518-233900540 CCCAATTAAAAAATGGACAAAGG + Intergenic
924221664 1:241882629-241882651 CTAACTTAAAAGATGGATAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924463270 1:244278364-244278386 CTTCATTAAAAAATGGGCAAAGG - Intergenic
924488280 1:244509129-244509151 CTGGATCAAAACAAGGATGAAGG - Intronic
1062776967 10:158882-158904 CGCAATTAAAACATGGATAAAGG - Intronic
1063095513 10:2905244-2905266 CTGGATTAAATATTCTATAAGGG + Intergenic
1063752207 10:8962935-8962957 CTCGATTAAAAAGTGGGCAAAGG + Intergenic
1064157157 10:12912443-12912465 CTGATTTAAAAAATGGGCAAAGG - Intronic
1064158640 10:12924576-12924598 GTGGATTAGAAACTGGAAAATGG - Intronic
1064284221 10:13978471-13978493 CCGGATTAGAAAATGGCAAATGG - Intronic
1064777931 10:18800394-18800416 CTCCATTAAAAAATGGGTAAGGG + Intergenic
1064813979 10:19235442-19235464 CCCGATTAAAAAATGGGCAAAGG - Intronic
1064845659 10:19649555-19649577 CTCCATTAAAAAGTGGACAAAGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065439228 10:25732650-25732672 CCCAATTAAAAAATGGACAAAGG - Intergenic
1065906425 10:30256973-30256995 CCCTATTAAAAAATGGACAAGGG - Intergenic
1065935935 10:30520459-30520481 CTGGGTTAAAAAGTGGGCAAAGG + Intergenic
1066045496 10:31591685-31591707 CAGGATAAAAAAATGAAGAAAGG - Intergenic
1066678331 10:37912165-37912187 CTGGTTAAAAAACTGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067193636 10:44094201-44094223 ATGCATTAAAAAATGAAAAAGGG + Intergenic
1067218165 10:44320764-44320786 CTGATTTAAAAAATAGATGAAGG + Intergenic
1067265632 10:44741513-44741535 CTCGGTTAAAAAGTGGCTAAAGG + Intergenic
1067355658 10:45523222-45523244 CTGCATTAAAAAATAAATTAGGG + Intronic
1067559339 10:47294029-47294051 CTGGATTTGGAAGTGGATAAGGG - Intergenic
1068069275 10:52175817-52175839 TGGGATTAAAAAATGGGCAAAGG - Intronic
1068077264 10:52271887-52271909 CAGTACTAATAAATGGATAATGG + Intronic
1068216253 10:53986126-53986148 CTCAATTAAGAAATGGGTAAAGG + Intronic
1068286159 10:54938868-54938890 CTGGCTTTGAAAATGGAGAAAGG + Intronic
1068436482 10:56998495-56998517 CTTTATTTAAAAATGGGTAAAGG + Intergenic
1068440672 10:57051683-57051705 CATCATTAAAAAATGGACAAAGG - Intergenic
1068456645 10:57263881-57263903 CTGGAATATAAACTCGATAAGGG - Intergenic
1068566602 10:58582769-58582791 CTGGCTTTAAAAATGGAGGAAGG - Intronic
1069298195 10:66873539-66873561 CTCCATTAAAAAATGGACAGAGG - Intronic
1069439647 10:68416505-68416527 CTGGATTAAAAAAGGGTTATAGG + Intronic
1069805450 10:71120087-71120109 CCGCATTAAAAAGTGGGTAAAGG - Intergenic
1070680901 10:78448358-78448380 CTGGATGAAAAAATGAATGGGGG + Intergenic
1070736454 10:78866758-78866780 GTGAATTCAAAAGTGGATAATGG + Intergenic
1071538113 10:86453336-86453358 CTGAAATAAGAAATGGATACAGG + Intronic
1071612546 10:87044773-87044795 GTGATTTAAAAAATGCATAAAGG - Intergenic
1071701579 10:87944455-87944477 ATAGATTACAGAATGGATAAAGG + Intronic
1072177719 10:92945194-92945216 CTGAATTAAAAAGTGGGCAAAGG - Intronic
1072417053 10:95257481-95257503 CTCGATTAAAAAATGATCAAAGG + Intronic
1072869810 10:99105406-99105428 CCTGATTAAAAAATGGGAAAAGG - Intronic
1073595790 10:104798864-104798886 CCCCATTAAAAAATGGATAAAGG + Intronic
1074202766 10:111253893-111253915 CCTGATTAAAAAATGGGCAAAGG + Intergenic
1074210318 10:111326674-111326696 CTCCATTAAAAACTGGACAAAGG - Intergenic
1074625901 10:115186145-115186167 CCCGATTAAAAAATGGGCAAAGG + Intronic
1075215837 10:120533338-120533360 CCGGATTTAAAAATGGGCAAAGG - Intronic
1075607225 10:123820746-123820768 CTGGCTTTGAAGATGGATAAAGG - Intronic
1075688035 10:124377513-124377535 ATGGTTTAGAAAATGAATAAAGG + Intergenic
1076077621 10:127548273-127548295 CTGCATTAATAAATGGATTCAGG - Intergenic
1077204315 11:1334929-1334951 CTCAATTAAAAAATGGCAAAGGG - Intergenic
1077758082 11:5057872-5057894 CTGGATTAGAAAAAGGACATTGG - Intergenic
1077920231 11:6636508-6636530 CTGTCTTAAAAAATAAATAAAGG - Intronic
1078116031 11:8451901-8451923 CTGGATAAAAAAATGCAAAGAGG + Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079779246 11:24578555-24578577 CTGGATTAAAAAAAAAAAAATGG + Intronic
1079790432 11:24731190-24731212 TTAGATTAAAAAATGTATGAAGG + Intronic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1080545161 11:33309717-33309739 ATGGATTGATAAATGGATAGAGG - Intronic
1080571042 11:33557583-33557605 CTGGATTAAACAATTAAAAAGGG + Intronic
1080715375 11:34795086-34795108 CAGTATTAAAAAAAGAATAATGG + Intergenic
1081370358 11:42293014-42293036 CTCCATTAAAAAGTGGGTAAAGG + Intergenic
1082022786 11:47548936-47548958 CTTGATTAAAAACTGGGAAATGG + Intronic
1082942238 11:58718791-58718813 ATGGATTAAAAAAAGGTTTAAGG + Intronic
1082969872 11:59008799-59008821 CTGGATAACAAAAAAGATAAGGG + Intronic
1084521620 11:69666664-69666686 CAGCATTAAAAAATGGTGAAGGG - Exonic
1084839991 11:71838734-71838756 CTGGCTTTGAAAATGGATGAAGG - Intergenic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1085150079 11:74244587-74244609 CCTGATTAAAAAATGGTCAAAGG - Intronic
1085343208 11:75747332-75747354 CCTAATTAAAAAATGGACAAAGG + Intergenic
1085500852 11:77022082-77022104 ATGAATTAAAAAATGTATCACGG - Exonic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086353625 11:85969486-85969508 TTGGATTAAAAAATTATTAAGGG - Intronic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1087028933 11:93682523-93682545 CTGCATTAAAAAAATGGTAATGG - Intronic
1087394311 11:97577425-97577447 GAGGATTAAAAACTGGATAGTGG - Intergenic
1088044189 11:105427737-105427759 CTGGATTAAGAATTGGATTAAGG - Intergenic
1088520787 11:110697402-110697424 CTCCATTAAAAAATGGGCAAAGG - Intronic
1089168556 11:116496865-116496887 CTGGATTTAAAAATTGGCAAAGG - Intergenic
1089722151 11:120435863-120435885 CTGAATTAAACAATGGATCTAGG - Intronic
1090127468 11:124102640-124102662 CCTGATTGAAAAATGGGTAAGGG - Intergenic
1090218827 11:124997215-124997237 ATGGCTAAAAAAATGGGTAATGG + Intronic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091380467 12:54950-54972 CTGGATTTAAAAGTGGAATAAGG - Intergenic
1091543082 12:1480479-1480501 CAGTATTAGAAAATGGAGAATGG + Intronic
1092010594 12:5108152-5108174 CCTGATTAAAAAGTGGACAAAGG - Intergenic
1092393586 12:8104305-8104327 CTGGAATGAAAAAAGGAAAATGG - Intergenic
1092439734 12:8489301-8489323 TTGATTTAAAAAATGGAGAAAGG + Intergenic
1092751214 12:11720888-11720910 CTCCATTAAAAAATGGGCAAAGG + Intronic
1093015856 12:14153864-14153886 CCCAATTAAAAAATGGATAAAGG + Intergenic
1093274048 12:17101796-17101818 CCCGATCAAAAAATGGGTAAAGG + Intergenic
1093655818 12:21693341-21693363 CCCCATTAAAAAATGGACAAAGG + Intronic
1093858924 12:24139411-24139433 CAGGATGGAAAAATGGAAAAAGG + Intergenic
1094128881 12:27053430-27053452 CTCCATTAAAAAGTGGGTAAAGG - Intronic
1095574341 12:43718196-43718218 CTTGATTAAAATATGGACAAAGG - Intergenic
1095838610 12:46667153-46667175 CTAGATTAAAAAAATAATAAGGG - Intergenic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1096728346 12:53583864-53583886 CCTGATTAAAAAATGGGCAACGG + Intronic
1096887107 12:54729069-54729091 CTGGATTTTAAAATTGATACTGG + Intergenic
1097370352 12:58771238-58771260 CTCCATTAAAAAGTGGACAAAGG + Intronic
1097406495 12:59196454-59196476 CTGTATTAAAAAAAGAAAAAAGG - Intergenic
1097624816 12:61987262-61987284 CTGAATTAAAAAAGCAATAAAGG + Intronic
1097813923 12:64050683-64050705 CTGGATTAAAAAATACTTAAGGG - Intronic
1097903236 12:64893781-64893803 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1098429585 12:70405307-70405329 CTGATTTAAAAAAAGGCTAAGGG + Intronic
1098674524 12:73272091-73272113 CTGCATTAAAAAGTGGGTAAAGG + Intergenic
1099032454 12:77544257-77544279 CCCCATTAAAAAATGGACAAAGG + Intergenic
1099111633 12:78569175-78569197 CTGGATAAAAAAGGGTATAATGG + Intergenic
1099246277 12:80196918-80196940 CTGAATTATAAAATGGAGGAGGG - Intergenic
1099394951 12:82126377-82126399 CTGCATTAAAAAGTGGGCAATGG + Intergenic
1099980524 12:89596436-89596458 TTGGATTAAAAAAGCTATAAAGG + Intronic
1100114808 12:91291550-91291572 CTCCATTAAGAAATGGGTAAAGG - Intergenic
1100129579 12:91474854-91474876 GTGGATAAAAAAGTGGAGAAAGG - Intergenic
1100944285 12:99762826-99762848 CCCCATTAAAAAATGGGTAAAGG + Intronic
1101270742 12:103141489-103141511 ATGGATTGATGAATGGATAAAGG + Intergenic
1101310876 12:103577548-103577570 CCAGATTAAAAAATGGGCAAAGG + Intergenic
1101469694 12:104984975-104984997 CCAGATTAAAAAATGGGTAAAGG + Intergenic
1101566950 12:105915772-105915794 CCTGATTAAAAAATGGGCAAAGG - Intergenic
1101938126 12:109075809-109075831 CATGATTAAAAAATGGGCAAAGG - Intronic
1102061401 12:109934679-109934701 ATGGTTTAAAAAATGGGGAAAGG - Intronic
1102251143 12:111388306-111388328 CTGGTTGAAAGAATGGCTAATGG - Intergenic
1103232321 12:119341928-119341950 TGGGATTAAAAGATGAATAATGG - Intronic
1104257130 12:127148993-127149015 CAGGATTAAAAAAGGTACAAAGG - Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105494125 13:20915599-20915621 CCTGATTAAAAAATGGACAAAGG + Intergenic
1105592577 13:21808094-21808116 TCTGATTAAAAAATGGAGAAAGG + Intergenic
1105684142 13:22761231-22761253 CTTGATTAAAAAATGAGCAAGGG + Intergenic
1105823615 13:24102302-24102324 CCCAATTTAAAAATGGATAAAGG - Intronic
1105988377 13:25592185-25592207 CCTGATTAAAAAATGGGCAAAGG - Intronic
1106024256 13:25941696-25941718 CTGGTTTAAAGAATGGACACAGG - Intronic
1106030909 13:26001693-26001715 CTTGATTAAAAAATGGGCAAAGG - Intronic
1106677617 13:31977836-31977858 CTTGATTAAGGAGTGGATAAGGG - Intergenic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1107137010 13:36956168-36956190 TTTGATTAAAAAATGGGCAAGGG + Intronic
1107230934 13:38109534-38109556 CCTTGTTAAAAAATGGATAAAGG + Intergenic
1107332444 13:39316276-39316298 CCTGATTAAAAAATGGGCAAAGG - Intergenic
1107365769 13:39673054-39673076 CTAAATTAAAAAATGGGTAAAGG - Intronic
1107747457 13:43525801-43525823 CCTGATTAAAAAATGGGCAAAGG - Intronic
1108198585 13:48019828-48019850 CCTGATTAAAAAATGAACAAAGG - Intergenic
1108268277 13:48733696-48733718 CTGGCTTTGAAAATGGAGAAGGG + Intergenic
1108300176 13:49065719-49065741 CTGGATTTGAAAAGGAATAAGGG + Intronic
1108375722 13:49812241-49812263 TTTTTTTAAAAAATGGATAATGG + Intergenic
1108385199 13:49893389-49893411 CTTGATTAAAAAATATATATAGG + Intergenic
1108786385 13:53907623-53907645 ATGGAGCAAAAAATGGATGAAGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1108976768 13:56454243-56454265 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
1109077918 13:57861564-57861586 CTGCATTAAAAAATGAGTTAGGG + Intergenic
1109127594 13:58537072-58537094 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1109162201 13:58990075-58990097 CTGGATTAAAAAATTTTAAAGGG - Intergenic
1110031313 13:70618248-70618270 CTTCATTAAAAAATGGGCAAAGG + Intergenic
1110446391 13:75587232-75587254 ATTTATTAAAAAATGGAGAAGGG + Intronic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1110861837 13:80352981-80353003 CTCAATTAAAACATGGAAAAAGG - Intergenic
1110923869 13:81125757-81125779 TGGGATTAAAAAATGGGCAAAGG - Intergenic
1111066839 13:83105312-83105334 TTGGATTATAAGATTGATAACGG + Intergenic
1112750166 13:102575093-102575115 CTGGATTAAAAAGTGGGCAAAGG - Intergenic
1113370587 13:109721688-109721710 CTGGATTAAAAAATAGACTATGG - Intergenic
1113538837 13:111090857-111090879 GTGCATTTTAAAATGGATAATGG + Intergenic
1113586018 13:111465890-111465912 CTGCATTAAAAAGTGGGGAAAGG - Intergenic
1113712079 13:112472672-112472694 CTACATTAAAAAATGGGCAAAGG + Intergenic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115003520 14:28451381-28451403 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1115004448 14:28465231-28465253 CCCCATTAAAAAGTGGATAAAGG - Intergenic
1115049635 14:29042066-29042088 ATGGATGAATAAATGAATAAAGG + Intergenic
1115103843 14:29736231-29736253 CTGGATAAAAATATGCATATTGG + Intronic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115570156 14:34658875-34658897 CTGAATTAAAATGTAGATAAGGG + Intergenic
1115705845 14:35997483-35997505 CTTGATCAAAAAATGGGCAAAGG - Intergenic
1115870840 14:37801086-37801108 CTGGTTTAAAAAGGGGAAAATGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116723164 14:48527109-48527131 CTCCATTAAAAAATAGACAAAGG - Intergenic
1117173398 14:53123761-53123783 CTGGATTAAAAACCGGAGAATGG + Intronic
1117813336 14:59571429-59571451 CCTGATTAAAAGATGGATAAAGG + Intronic
1117872320 14:60213949-60213971 ATGGATTAGAAAAAGGATCAAGG - Intergenic
1117927707 14:60801506-60801528 CTTGATTAGAAAATGGGCAAAGG + Intronic
1118506405 14:66417471-66417493 CTTGATCAAAAAATGGACCAAGG + Intergenic
1118615099 14:67569677-67569699 ATGGAGGAAAAAATGGTTAAAGG + Intronic
1118897897 14:69962075-69962097 CTGAATTAAGAAATGGGAAAAGG - Intronic
1119021091 14:71116076-71116098 CTGGATTAAAAAAAAGAATAAGG - Intergenic
1119871071 14:78017766-78017788 CCTGATTAAAAAATGGGCAAAGG + Intergenic
1119960978 14:78856439-78856461 CTGGATTCTAAAATGTATATTGG + Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120123871 14:80717043-80717065 CCCAATTAAAAAATGGATAAAGG - Intronic
1120374588 14:83686446-83686468 CCAGATTTAAAAATGGACAAAGG + Intergenic
1120391988 14:83920738-83920760 CCTGATTTAAAAATGGGTAAAGG + Intergenic
1120609783 14:86625271-86625293 TAGGAATAAAAAATGGAAAATGG - Intergenic
1121821257 14:96969133-96969155 CTAGATTAAAAAACGGGCAAAGG + Intergenic
1122145538 14:99686848-99686870 TTGGATTAAAAATTGGTTAGTGG + Intronic
1122404794 14:101493675-101493697 CTTGATTCAAAAATGGGTGAAGG + Intergenic
1122447169 14:101778243-101778265 CCCGATTAAAAAATGGGCAAAGG - Intronic
1123453032 15:20385359-20385381 CTGGCTTAGAAAATGGAAGAGGG + Intergenic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1124205084 15:27711167-27711189 GTGGATTTAAAATTGGATATTGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124843476 15:33266685-33266707 CGTGACTAAAAAATGGACAAAGG - Intergenic
1126222263 15:46227905-46227927 CTTGATTAAATAATGGGCAAAGG + Intergenic
1126283454 15:46984515-46984537 CCAGATTAAAAAATGGGCAATGG - Intergenic
1126496555 15:49297252-49297274 CTCCATTAAAAAATGGGCAAAGG - Intronic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1126986003 15:54309326-54309348 CATGATTAAAAAATGGGCAAAGG - Intronic
1127024329 15:54786173-54786195 CCTGATTAAAAAATAGGTAAAGG + Intergenic
1127494868 15:59500793-59500815 CTGGAACAAAAAATTGATAGAGG - Intronic
1127712826 15:61618240-61618262 CTTGATTAAAAAATGGGCAAAGG + Intergenic
1127840825 15:62830179-62830201 CTGGTTTATAAAGGGGATAACGG - Intronic
1129142724 15:73615550-73615572 TTGGATTAAATAATGTATATAGG - Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129744977 15:78012073-78012095 CTTGTTAAAAATATGGATAAAGG - Intronic
1129901247 15:79151783-79151805 ATGGAATAAAAAATAAATAACGG + Intergenic
1130032691 15:80329743-80329765 TAGGAGAAAAAAATGGATAAAGG + Intergenic
1130219454 15:82006886-82006908 CTGGATTCAAACATGGAAGAAGG + Intergenic
1130425323 15:83792178-83792200 CCTGATTAAAAAATGGGCAAAGG + Intronic
1130584022 15:85165537-85165559 CTTGATTCAAAAATGGGCAAAGG + Intergenic
1131110381 15:89761084-89761106 CTGGCTTAAGAAATAGATGAAGG + Intronic
1131505615 15:93015676-93015698 CTCGATTAAAAAGTGGGTAAAGG + Intronic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1133384192 16:5355510-5355532 CTGGGTTTAAAAATGGAGACTGG + Intergenic
1133447057 16:5870563-5870585 CTGGAATAAAAAAAGAATGAAGG - Intergenic
1133954594 16:10430296-10430318 CTGGATAAAAAAATAGTGAATGG + Intronic
1134208407 16:12256195-12256217 CCTGATTAAAAAATGGACACAGG - Intronic
1134258074 16:12627716-12627738 CTGGATAAAAAAAGTGTTAATGG - Intergenic
1134911803 16:18034048-18034070 CATGATTTAAAAATGGATGAAGG - Intergenic
1135084105 16:19461058-19461080 CTGGAATAGAAAATGGACATCGG + Intronic
1135528843 16:23235087-23235109 ATTGATGTAAAAATGGATAAGGG - Intergenic
1135876789 16:26208654-26208676 CCCAGTTAAAAAATGGATAAAGG + Intergenic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1137339564 16:47587207-47587229 CTGGATTAAAATATGAAGACAGG - Intronic
1137897689 16:52232033-52232055 CTCGACTAAAAAATGTATACAGG - Intergenic
1137977028 16:53040684-53040706 CTGAATTAATAAATGAATACAGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138636589 16:58344032-58344054 CCAGATTTAAAAATGGACAAAGG - Intronic
1139221683 16:65188884-65188906 CTAGATTGAAAAATCTATAAGGG - Intergenic
1139792451 16:69450356-69450378 CTGGGTTAAAAAGTGACTAAAGG + Intronic
1140588301 16:76321106-76321128 GTGGTTTAAAAAATAGAAAATGG - Intronic
1141285744 16:82669983-82670005 CAGGAATAAAAACTGCATAATGG - Intronic
1143428236 17:6857668-6857690 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148007275 17:44443673-44443695 CTGTTTTAAAAAATAAATAAAGG - Intronic
1148317858 17:46719677-46719699 ATTGATGCAAAAATGGATAAAGG - Intronic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1150447059 17:65234475-65234497 CTTGATTAGAAAATGGGCAAAGG + Intergenic
1150545005 17:66147323-66147345 CTAGATTAAAAGATGGGGAAAGG - Intronic
1150894089 17:69189351-69189373 CCCCATTAAAAAATGGACAAAGG - Intronic
1150993258 17:70285772-70285794 CATGATTTAAAAATGGAGAAAGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153417561 18:4865239-4865261 ATGGTTCAAAAACTGGATAATGG - Intergenic
1153605190 18:6826299-6826321 CTCCATTAAAAAATGGGCAAAGG - Intronic
1153785831 18:8534401-8534423 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1154216987 18:12422708-12422730 CTCAATTAAAAAATGTATATTGG + Intronic
1155523597 18:26693897-26693919 CTCGATTAAAAAATGGGTAAAGG - Intergenic
1155978213 18:32154482-32154504 GTGGGTTAGAAAATGAATAAAGG + Intronic
1156006772 18:32451534-32451556 CAGGATTAATAACTGGATAATGG - Intronic
1156471631 18:37380717-37380739 CTGGATGGATAAATGGATAGAGG - Intronic
1156797771 18:41069089-41069111 CAGTATTAAAAAGAGGATAAAGG + Intergenic
1157320949 18:46633788-46633810 CTTAATTTAAAAATGGATGAAGG + Intronic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1157875015 18:51264724-51264746 CCAGATTAAAAAATGGCCAAAGG + Intergenic
1158134865 18:54197134-54197156 CTGGTTTAATGAATGAATAAAGG - Intronic
1158248292 18:55456563-55456585 CTGGAATAATAAAAGGAAAATGG + Intronic
1158290721 18:55938932-55938954 CAGGAATGAAAAATGGACAAGGG + Intergenic
1158500605 18:57997361-57997383 CTGGCTTAAGAAATGGAGGAAGG - Intergenic
1158738043 18:60106290-60106312 CCCCATTAAAAAATGGACAAAGG + Intergenic
1158749820 18:60245726-60245748 CTCAATTAAAAAATGACTAAAGG + Intergenic
1159150836 18:64521600-64521622 CCTGATTTAAAAATGGGTAAAGG + Intergenic
1159573112 18:70143181-70143203 CTCCATTAAAAAGTGGACAAAGG - Intronic
1161628977 19:5341929-5341951 CTAGAATAAAAACGGGATAATGG - Intergenic
1161999404 19:7733673-7733695 TTAAATGAAAAAATGGATAAGGG - Intronic
1162242920 19:9371332-9371354 GTGGATTAAAAAAATGAAAAGGG - Intronic
1162243122 19:9373764-9373786 ATGGAATAAAAAATGGGTAAAGG - Intronic
1162604162 19:11694401-11694423 TTGGTTTAAAAAAGGAATAAAGG + Intergenic
1164954515 19:32370554-32370576 CTCGATTAAAAAATGGGCAAAGG - Intronic
1165185260 19:34014732-34014754 CCTGATTAAAAAATGGGCAAAGG + Intergenic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1166419313 19:42623849-42623871 CCCGATTAAAAAATGGACAAAGG + Intronic
1166456699 19:42947534-42947556 CCCAATTAAAAAATGGACAAAGG + Intronic
1166466656 19:43038400-43038422 CCCAATTAAAAAATGGACAAAGG + Intronic
1166493563 19:43281457-43281479 CCCAATTAAAAAATGGACAAAGG + Intergenic
1167704764 19:51074689-51074711 CCCAATTAAAAAATGGACAAAGG + Intergenic
1168445464 19:56408239-56408261 CTAGGTTAAAATATGGAAAATGG + Intronic
1168638147 19:58012427-58012449 GTGGATTAAAAGATAGTTAAAGG - Intergenic
924973351 2:151372-151394 GTAGAGTAAAAAATGGAGAAAGG - Intergenic
925568354 2:5281734-5281756 CCTGATTAAAAAATGAACAAAGG + Intergenic
925678842 2:6395608-6395630 CTTGAGTAAAAACTGGACAAGGG - Intergenic
925788845 2:7461674-7461696 CTCCATTAAAAAGTGGACAAAGG + Intergenic
925925624 2:8668101-8668123 ATGGATGGAAAAATGGATGAAGG + Intergenic
926482279 2:13414065-13414087 CTGGCTTAGAAAATGGAAGAGGG - Intergenic
926577680 2:14600348-14600370 CTGGATTAACAGATGGATCCTGG + Intergenic
926852076 2:17209953-17209975 CCTGATTAAAAAATGGACCAAGG - Intergenic
926939650 2:18121410-18121432 TCAGATTAAAAAATTGATAAAGG + Intronic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
927070267 2:19521500-19521522 CCCCATTAAAAAATGGACAAAGG + Intergenic
927348683 2:22079630-22079652 CTGGTTTACATAATAGATAAAGG - Intergenic
927473964 2:23397778-23397800 CTCCATTAAAAAATGGGCAAAGG + Intronic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
928870055 2:35965217-35965239 CTGAATTAAAAAGAGGAGAAAGG + Intergenic
928923143 2:36547370-36547392 CTTCATTAACCAATGGATAATGG - Intronic
929389257 2:41449834-41449856 CTTTATTAAAAAGTGGACAAAGG + Intergenic
929412199 2:41709512-41709534 CCCGATTAAAAAGTGGACAAAGG - Intergenic
930079622 2:47435082-47435104 CTGGATTTAAAAAAAAATAAAGG - Intronic
930314174 2:49777202-49777224 CCTGATTTAAAAATGGGTAAAGG - Intergenic
930344054 2:50156141-50156163 TTGGAATAAAAAAGGAATAAAGG + Intronic
930524347 2:52508174-52508196 TTGGCTTAAAAAATGTATGAGGG + Intergenic
930589430 2:53309722-53309744 CCCAATTAAAAAATGGACAAAGG + Intergenic
930670163 2:54141119-54141141 CTCGATAGAAAAATGGGTAAAGG - Intronic
931215259 2:60236151-60236173 CTGCATCAAAAAGTGGGTAAAGG - Intergenic
931710311 2:64984268-64984290 CCCGATTAAAAAATGGGCAAAGG - Intergenic
932048421 2:68374033-68374055 CTAGATTAATCAATTGATAATGG + Intronic
932518238 2:72377018-72377040 CTCGATTAAAAAATGGGTAAAGG + Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933336983 2:80971078-80971100 CTAGATTAACAAATAAATAAAGG + Intergenic
933422571 2:82069151-82069173 ATTGAATAAAAACTGGATAAAGG - Intergenic
933472141 2:82739646-82739668 CTGGATTACACAAGGAATAAAGG - Intergenic
933579959 2:84114462-84114484 CTCCATTAGAAAATGGATAAAGG - Intergenic
934485409 2:94704088-94704110 CCTAATTAAAAAGTGGATAAAGG - Intergenic
934914285 2:98287152-98287174 CTAGCTTAATAAATGGAAAAAGG - Intronic
936238258 2:110764939-110764961 CTGACTTAAAGAATGGCTAAAGG - Intronic
936734012 2:115418429-115418451 CTGTTTTAAAAAATGGCTTAAGG + Intronic
936756046 2:115713876-115713898 CTGGCTTTATAAATGGATGATGG - Intronic
936775058 2:115962872-115962894 CTCAATTAAAAAAATGATAAAGG - Intergenic
938259745 2:129887073-129887095 CTGAATTCCAAAATGGATGAGGG + Intergenic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
939093793 2:137809191-137809213 CTCCATTAAAAAATGGGCAAAGG - Intergenic
939731950 2:145795893-145795915 TTAGAAAAAAAAATGGATAATGG - Intergenic
939747831 2:145999495-145999517 CTCCATTAAAAAGTGGACAAAGG + Intergenic
939833268 2:147097878-147097900 CTGGATTTAAAAAAGAAAAATGG - Intergenic
939853138 2:147323668-147323690 CCTGATTAAAAACTAGATAAAGG + Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940295037 2:152113881-152113903 CTTGATTAAAAAATGAGCAAAGG + Intergenic
940579436 2:155558896-155558918 CTCCATTAAAAAGTGGGTAAAGG + Intergenic
940981516 2:160008867-160008889 CCCAATTAAAAAATGGACAAAGG + Intronic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941390020 2:164900623-164900645 CTTGATTAAAAAATGGGCAAAGG - Intronic
941743171 2:169058121-169058143 CTCCATTAAAAAGTGGACAAAGG + Intergenic
941777466 2:169408449-169408471 CTGGATTAAAAAATAAAGTATGG + Intergenic
942190898 2:173469307-173469329 CTCAATTAAAAAATGGGTAAAGG - Intergenic
942643023 2:178079969-178079991 CCCCATTAAAAAATGGACAAAGG - Intronic
942674089 2:178408187-178408209 TTGGATTAAAAAATGAGTAAAGG - Intergenic
942719572 2:178935918-178935940 CTCCATTAAAAAGTGGATAAAGG - Intronic
943006070 2:182389420-182389442 CCCAATTAAAAAATGGACAAAGG + Intronic
943071601 2:183147444-183147466 CAAAAATAAAAAATGGATAAAGG - Intronic
943703944 2:191015198-191015220 ATGGATTAAAAGGTAGATAAGGG - Intronic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
943956864 2:194202813-194202835 ATCCATTAAAAAATGGACAATGG - Intergenic
943976519 2:194485391-194485413 GAGGATTTAAAAATGGAAAAGGG + Intergenic
944115735 2:196184417-196184439 ATGGATGAAAGAATGGACAAAGG + Intergenic
944175535 2:196824929-196824951 CCTGATTAAAACATGGGTAAAGG + Intergenic
944292777 2:198026668-198026690 CTTGATTAAAAATTGGGCAAAGG + Intronic
944511235 2:200468319-200468341 CTGGGTGAAAAAGTGGATAAGGG - Intronic
944862514 2:203828512-203828534 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
945214351 2:207417449-207417471 CTGGTGTAAAAGATAGATAAAGG - Intergenic
945379786 2:209126753-209126775 CTGATTTTAAAAATGGGTAAAGG - Intergenic
945402672 2:209405279-209405301 CTGGTTTTAAAGATTGATAAAGG + Intergenic
945635873 2:212349968-212349990 CTTGATGAAAAAATGAACAAAGG + Intronic
945849207 2:214985069-214985091 CTGGATTAAATTATGAACAAAGG + Intronic
946081208 2:217120088-217120110 TTGGATTCTAGAATGGATAATGG + Intergenic
946135053 2:217639087-217639109 CTTGATTAAAAAATGGGCAAAGG + Intronic
946975307 2:225141851-225141873 CTGGAATAAATACTGGATACTGG - Intergenic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
947298971 2:228666697-228666719 CTTGTTTATAAAATGGAAAATGG + Intergenic
948416014 2:237804609-237804631 CTTTATTAAAAAATGGGCAAAGG - Intronic
1168868859 20:1112086-1112108 CTCAGTTAAAAAATGGGTAAAGG + Intergenic
1169182894 20:3585758-3585780 CCCAATTAAGAAATGGATAAAGG + Intronic
1169269123 20:4185999-4186021 CTGGATTAAAAACTGCATTCTGG + Intronic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1169846016 20:9992365-9992387 CCTGATTAAAAAATGGTCAAAGG + Intronic
1169857747 20:10122360-10122382 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
1170619564 20:17983767-17983789 CTTGATTAAAAAATGGGCAAAGG - Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172029457 20:31971438-31971460 TTGGATTCTAAAATGGCTAAGGG + Intronic
1172395745 20:34603432-34603454 TTGTATTGAAAACTGGATAAAGG - Intronic
1173015062 20:39217684-39217706 ATAAATTTAAAAATGGATAAAGG - Intergenic
1173961553 20:47076526-47076548 CCCGATTAAAAAATGGGCAAAGG - Intronic
1174510654 20:51049567-51049589 CTGGTTTAAATAATGGACAAAGG + Intergenic
1174990356 20:55502335-55502357 CTGGTTGAAAAAAAGGAGAAAGG + Intergenic
1176608803 21:8857944-8857966 CAGGACTAAAAAATGTATTATGG - Intergenic
1176926060 21:14750324-14750346 ATGGAATAAGAAATGGACAAAGG + Intergenic
1177231065 21:18320656-18320678 CTGGATGAAAAAATGCTGAATGG + Intronic
1177303570 21:19283212-19283234 ATGGAATAAAAAATGAATAGGGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177627691 21:23685008-23685030 CTGTCTTAAAAAATGAATAGAGG - Intergenic
1177658718 21:24054628-24054650 TTATATTAAAAAATGTATAAAGG + Intergenic
1177680113 21:24356745-24356767 CTTCATTAAAAAATGGGCAAAGG - Intergenic
1177841774 21:26242455-26242477 CCTGATTTAAAAATGGACAAAGG - Intergenic
1177914273 21:27068879-27068901 CTGGCTTTAAAAATGGAGGAAGG + Intergenic
1178004339 21:28199672-28199694 CCCCATTAAAAAATGGACAAAGG + Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG + Intronic
1178971185 21:37178620-37178642 CTCAATTCAAAAATGAATAAAGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181279938 22:21712412-21712434 ACAGGTTAAAAAATGGATAAAGG + Intronic
1181279998 22:21712833-21712855 TCTGATTAAAAAATGGACAAAGG + Intronic
1181292087 22:21803430-21803452 CTAGTTTAAAAAATGGACAAAGG - Intronic
1181329946 22:22082499-22082521 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181828835 22:25542494-25542516 CTTGATTAGAAAAGTGATAAAGG - Intergenic
1181840589 22:25656220-25656242 CTAGATTTAAAAATAAATAATGG + Intronic
1182398919 22:30059680-30059702 TTGGAATAAACAATGGATCAAGG + Intergenic
1182537567 22:31016606-31016628 CTGAATTAAAGAATGGGGAAAGG - Intergenic
1182887187 22:33784544-33784566 CTGGTTTAAAAAGTGAATTAGGG - Intronic
1182937375 22:34238034-34238056 CCCCATTAAAAAATGGACAAAGG + Intergenic
1183660539 22:39218126-39218148 CTCCATCAAAAAATGGGTAAAGG + Intergenic
1183852491 22:40602551-40602573 TTGGTTTAAAAAATAGTTAAAGG + Intronic
1183891150 22:40929836-40929858 CTGTATTAAAAAATTACTAAAGG - Exonic
1184318727 22:43722062-43722084 CCCCATTAAAAAATGGACAAAGG + Intronic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949325880 3:2863815-2863837 CTGGATTAAACAAAGTAAAACGG - Intronic
949907543 3:8871177-8871199 CCCGATTAAAAAATGGGCAAAGG + Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950694357 3:14686650-14686672 CTTGATTTAAAAATGGATTAAGG - Intronic
951210333 3:19967444-19967466 CCTGATTAGAAAATGGACAAAGG - Intronic
951786353 3:26423629-26423651 TTGGATAAAAAAATGTTTAATGG - Intergenic
951904098 3:27687182-27687204 CTGGATTACAAATTGTATATAGG - Intergenic
951936339 3:28026884-28026906 CTCAATTTAAAAATGGGTAAAGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952135880 3:30418919-30418941 CCTGATTAAATAATGGACAAAGG - Intergenic
952598275 3:35045222-35045244 CTGGAATAAAAAATAGGAAAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953478374 3:43225975-43225997 CCTGATTAAAAAATGGGCAAAGG - Intergenic
953780367 3:45863789-45863811 CTGGATTAAAAGATAGAGAGAGG + Intronic
953833122 3:46319397-46319419 CTGGATTAAAAAATGAGCAAAGG - Intergenic
955399924 3:58584337-58584359 CTGGATGAATAAATGAATGAAGG + Intronic
955557848 3:60157196-60157218 ATGGATTGAAAAATGCAAAAGGG + Intronic
955807462 3:62752507-62752529 TCGAATTAATAAATGGATAATGG - Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
956997323 3:74842581-74842603 CTGTATAAAAATATGTATAATGG - Intergenic
957238618 3:77627781-77627803 TTGGTTGAAAAAATGGAGAATGG + Intronic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
957944946 3:87052211-87052233 CAGGATTAAAAACTTGATGAAGG - Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958443856 3:94190945-94190967 TTGGATTAGAAAATGGGTATTGG - Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958618163 3:96523167-96523189 TTTGATTAAAAAATGGGCAAAGG - Intergenic
958703483 3:97622925-97622947 CCTGATTCAAAAATGGAAAATGG - Intronic
958863738 3:99475539-99475561 ATGGATTATAAAATTGACAAAGG - Intergenic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959826266 3:110800184-110800206 CCTGATTAACAAATGGACAAAGG - Intergenic
959874812 3:111370435-111370457 CTCTATTAAAAAGTGGGTAAAGG + Intronic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960597984 3:119424152-119424174 CTGAATTAAAAAATAGGCAAGGG - Intergenic
960624538 3:119668155-119668177 TTGTTTTAAAAAATGTATAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961932031 3:130544854-130544876 CCTGAATAAAAAATGGGTAAAGG - Intergenic
962047884 3:131779998-131780020 CTGCATTAAAAAATGGGCAAAGG + Intronic
962223818 3:133587390-133587412 CTGTCTTAAAAAATGTGTAAGGG + Intronic
962510390 3:136093570-136093592 CCAGTTTAAAAAATGGACAAAGG + Intronic
962997066 3:140640561-140640583 CCCCATTAAAAAGTGGATAAAGG - Intergenic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
963747253 3:149137140-149137162 CTTGATTAAAAAATGGGCTAAGG + Intronic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
963913394 3:150834943-150834965 CTCCATTAAAAAATGGGCAAAGG - Intergenic
964554377 3:157919621-157919643 CTAGATTCAAAAATGCATAATGG - Intergenic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964903020 3:161682768-161682790 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
965049763 3:163630700-163630722 CTCCATTACAAAATGGACAATGG - Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965110649 3:164416874-164416896 CTGGATTTAAAAAAGACTAAAGG + Intergenic
965224757 3:165973658-165973680 CTTCATTAAAAAGTGGACAAGGG + Intergenic
965268579 3:166582526-166582548 CTCCATCAAAAAATGGACAAAGG - Intergenic
965430915 3:168587318-168587340 CTTCATTAAAAAATGGGCAAGGG - Intergenic
965579022 3:170247354-170247376 CTGGATTAAACAGTGGTTTAAGG - Intronic
965655818 3:170983564-170983586 CCCGATTTAAAAATGGACAAAGG - Intergenic
965915505 3:173841652-173841674 CTGGAGAACAAAATGTATAAAGG + Intronic
966284798 3:178282331-178282353 CCAGATTAAAAAATGAAGAAAGG + Intergenic
966434064 3:179863499-179863521 CTTGATTTAAAAATGGGAAAAGG + Intronic
966518895 3:180851186-180851208 CCTGATTAAAAAATGGGCAAAGG - Intronic
966610393 3:181862336-181862358 CTGGAGTGAAAAATGTAGAAAGG - Intergenic
966963752 3:184968693-184968715 CCCAATTAAAAAATGGGTAAAGG - Intronic
967526529 3:190501438-190501460 CTTGATTAAACAATGGGCAAAGG - Intergenic
967653791 3:192020576-192020598 CCTGATTAAAAAATGGATAAAGG + Intergenic
968073004 3:195799307-195799329 CTGGAAAAAAAAATGTTTAAAGG - Intronic
969038638 4:4276414-4276436 CAGCATTAGAAAATGGATACTGG + Intronic
969531203 4:7732112-7732134 CTCGATTAAAAAACGGGCAAAGG + Intronic
969781080 4:9404734-9404756 CTGGCTTTGAAAATGGATGAAGG - Intergenic
969939706 4:10718641-10718663 CTGTTTTAACAAATGGCTAAAGG + Intergenic
970493013 4:16595290-16595312 CTGGATTCAAATTTGAATAAGGG - Intronic
970826402 4:20281131-20281153 CTGGTTAAAAAAATGATTAAAGG + Intronic
971402674 4:26290890-26290912 CTGGTTTAAGAAATAAATAAAGG - Intronic
971884749 4:32429430-32429452 CTGTCTTTGAAAATGGATAATGG + Intergenic
972030711 4:34454171-34454193 CTCCATTAAAAAGTGGACAAAGG + Intergenic
972194262 4:36633988-36634010 CTCTATTAAAAAATGGGTTAAGG + Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
972518455 4:39831479-39831501 CTGCATTAAAAAACAGCTAATGG - Intronic
972981448 4:44708450-44708472 CTGGATTTAAAAAAGGATTAGGG + Intronic
973025770 4:45268366-45268388 CTAAATTAAAAAATGGATGTGGG - Intergenic
973990603 4:56403166-56403188 CAGGATTAAAAACTTGATGAAGG - Exonic
974216663 4:58856071-58856093 CCCCATTAAAAAGTGGATAAAGG - Intergenic
974351783 4:60757100-60757122 CACGATTTAAAAATGGGTAAAGG + Intergenic
974543545 4:63270486-63270508 CCTGATTAAAAAATGAACAAAGG - Intergenic
974631861 4:64501680-64501702 CTGAATTAAAATTTAGATAAAGG + Intergenic
974728116 4:65823156-65823178 CTGGCTTTGAAAATGGAAAAAGG + Intergenic
975268836 4:72404876-72404898 CTCGATTAAAGAATGGGTGAAGG + Intronic
975478398 4:74849458-74849480 CTCCATTAAAAAGTGGACAAAGG - Intergenic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
976436657 4:85026178-85026200 CCTGATTAAAAAATGGACAAAGG - Intergenic
976759258 4:88530563-88530585 GTGGATTAAAAAATGAGGAAAGG - Intronic
976851771 4:89555784-89555806 CTGGATTTTAAAATGGGCAAAGG - Intergenic
977009082 4:91613001-91613023 ATGGAGCAAAAAATGGACAATGG + Intergenic
977432381 4:96946657-96946679 CCGCATTAAAAAGTGGACAAAGG + Intergenic
977492796 4:97735861-97735883 CTCGATTTAAAAATGGGCAAAGG + Intronic
977776540 4:100927568-100927590 CTGGCTTAAAAAATGAAGTACGG - Intergenic
977856265 4:101898321-101898343 CTTGATTAATATATGTATAAAGG - Intronic
977903703 4:102451862-102451884 ATGGGTTAAAAAATGGAAATAGG - Intergenic
978870489 4:113570963-113570985 CCTGATTAAAAAATGGACAAAGG + Intronic
979219197 4:118201606-118201628 CTTCATTAAAAAATGGGCAAAGG - Intronic
979592763 4:122499141-122499163 CTGGAAGAATAAATAGATAATGG - Intergenic
979886805 4:126037284-126037306 TTGGAATAAAATATGGATTAGGG + Intergenic
980117571 4:128694206-128694228 CCTGATTAAAAAATGGGCAAAGG + Intergenic
980295128 4:130904185-130904207 ATTTATTAAAAAATGTATAATGG - Intergenic
980696048 4:136356808-136356830 TTGGCTTTAAAAATGGAAAAAGG + Intergenic
981402317 4:144327780-144327802 CCCCATTAAAAAATGGGTAAAGG + Intergenic
981466567 4:145079195-145079217 CTCTATTAAAAAATGGGCAAAGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
981907334 4:149936644-149936666 CCTGATTAAAACATGGGTAAAGG - Intergenic
981959223 4:150515032-150515054 CTGGCTTAATAAATGAATTATGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983103652 4:163658223-163658245 CCCCATTAAAAAGTGGATAAAGG + Intronic
983332694 4:166351650-166351672 AAGGATAAATAAATGGATAATGG - Intergenic
983864084 4:172742689-172742711 CTGGACTGAAAGATGGCTAAAGG - Intronic
984003449 4:174280155-174280177 CATGATTCAAAAATGGGTAAAGG + Intronic
984018810 4:174459484-174459506 CCTGATTAAAAAATGGGCAAAGG - Intergenic
984680536 4:182603716-182603738 CTAGATTAAAAAATAGTTAAAGG - Intronic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985178262 4:187226741-187226763 CCTGATTAAAAACTGGATTAAGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986263626 5:6173062-6173084 CCTGATTAAAAAATGAACAAAGG + Intergenic
986460773 5:7969538-7969560 CTTGATTAAATCAAGGATAAAGG + Intergenic
986782566 5:11080141-11080163 CCTGATTAAAAAATGGACAAAGG + Intronic
986907082 5:12508081-12508103 CTCCATTAAAAAATGGGCAAAGG - Intergenic
986953898 5:13126534-13126556 ATGGATTAAGAAATATATAATGG - Intergenic
987211159 5:15684741-15684763 CTAGCTTTAAAAATGGAGAAGGG + Intronic
987240091 5:15987773-15987795 CTTGATTAAAAAATGGGCAGTGG - Intergenic
987956031 5:24741335-24741357 CCCAATTAAAACATGGATAAAGG - Intergenic
988860896 5:35277357-35277379 CTGGCTTGAGAATTGGATAAAGG - Intergenic
989132497 5:38121755-38121777 CCCAATTAAAAAATGGACAAAGG - Intergenic
989403037 5:41029294-41029316 CCTGATTTAAAAATGGACAAAGG - Intronic
989954399 5:50340443-50340465 CCCAATTTAAAAATGGATAAAGG + Intergenic
990257202 5:53983005-53983027 CTGCATCAAAAACTGGACAAAGG - Intronic
990940279 5:61195717-61195739 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
991141777 5:63252656-63252678 CTGGATTAATAAATCTAGAAGGG - Intergenic
991192215 5:63887901-63887923 CTAGATTAGAAAATGGAGTAAGG + Intergenic
991222048 5:64227915-64227937 ATGGTTTTAAAAATGGGTAAGGG - Intronic
991226576 5:64280149-64280171 CTCCATTAAAAAATGGGCAAAGG - Intronic
992283829 5:75211812-75211834 CTGAATTAAAAAATGAGTAAAGG - Intronic
992337491 5:75787756-75787778 TTTGATTAAAAAATGGGCAAAGG + Intergenic
992433141 5:76729328-76729350 CCTGATTTAAAAATGGACAAAGG - Intronic
993166963 5:84368789-84368811 CTCGATTCAAAAATGGGCAAAGG + Intronic
993314348 5:86381028-86381050 CTGCATTAGAGAATGAATAAAGG + Intergenic
993419403 5:87682313-87682335 CCAGATTAAAAAATGGGCAAAGG - Intergenic
993419885 5:87687794-87687816 ATAGTTTAAAAAATGGACAAAGG - Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
993625387 5:90218415-90218437 CCTGATTCAAAAATGGACAAAGG + Intergenic
993785909 5:92135442-92135464 CTCAATTAAAAAATGACTAAAGG - Intergenic
993988587 5:94627472-94627494 CTACATTAAAATATGGATTAAGG + Intronic
994631087 5:102288727-102288749 CTGGAGAAAAATATGGTTAAGGG - Intronic
994638998 5:102381890-102381912 CCTGATTAAAAAATGAACAAAGG - Intronic
994727904 5:103458095-103458117 CCTGATTAAAAAATGGGCAAAGG - Intergenic
994765035 5:103904697-103904719 CTCCATTAAAAAATGGGCAAAGG + Intergenic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995301088 5:110583802-110583824 CTTGATTACAAAATGGGCAAAGG + Intronic
995360599 5:111292590-111292612 CATGATTAAAAAAAGGCTAAGGG - Intronic
995816203 5:116171146-116171168 CTGCATCAAAAAATGGGCAAAGG + Intronic
995839963 5:116434689-116434711 CCTGATTAAAAATTGGACAAAGG - Intergenic
996451793 5:123634005-123634027 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
996750698 5:126885591-126885613 CTTGATTAAAAAAAGAAAAAAGG + Intronic
997017738 5:129956378-129956400 CTCCATTAAAAAGTGGACAAAGG - Intronic
997181649 5:131835113-131835135 CTAGATTAAAAAATGCTCAAAGG - Intronic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
998259310 5:140616742-140616764 CATGATTAAAAAATGGGCAAAGG + Intergenic
998718252 5:144910866-144910888 CTCTATTAAAAAGTGGGTAAAGG + Intergenic
998727865 5:145039160-145039182 CCAGTTTAAAAAATGGATAAAGG - Intergenic
998928218 5:147151406-147151428 CCTGATTTAAAAATGGACAAAGG + Intergenic
999665912 5:153912914-153912936 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
999950470 5:156643742-156643764 TTAGATTATAAAATGGAGAAAGG - Intronic
1000729712 5:164818372-164818394 CTAGATTAAGAAATAGATCATGG - Intergenic
1001114376 5:168926671-168926693 CATGATTAAAAAATGGGTAAAGG + Intronic
1001205476 5:169758494-169758516 CAAGATTAAAAAAGGGATGAAGG + Intronic
1001872867 5:175171882-175171904 ATGGATGAATAAATTGATAATGG - Intergenic
1002385409 5:178862067-178862089 TTAGATAAAAAAATGAATAAAGG - Intronic
1002545144 5:179937365-179937387 CCTGATTAAAAAATGGGCAAAGG + Intronic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003691078 6:8354341-8354363 CTGGTTTAAAAAATGGTTGAGGG + Intergenic
1004539121 6:16532533-16532555 CTTGATTAAAAAATGGGCAAAGG + Intronic
1004833657 6:19506069-19506091 CTCCATTAAAAAGTGGGTAAAGG - Intergenic
1004960328 6:20781162-20781184 CTGGGTCAGAAAAAGGATAATGG + Exonic
1005123374 6:22416676-22416698 CCTGATTAAAATATGGACAAAGG + Intergenic
1005203450 6:23373609-23373631 CTGGAGTAAAAAAATTATAAAGG - Intergenic
1005851063 6:29822659-29822681 CTTCATTAAAAAGTGGACAAAGG + Intergenic
1005908530 6:30287360-30287382 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1007283887 6:40733616-40733638 ATGGATTAATAGATGAATAAGGG + Intergenic
1007288628 6:40767052-40767074 CTTCATTAAAAAATGGGCAAAGG - Intergenic
1008117248 6:47566197-47566219 GAGAATTAAAAAGTGGATAATGG - Intronic
1008262345 6:49382083-49382105 CCCCATTAAAAAATGGACAAAGG - Intergenic
1008442672 6:51550516-51550538 TTGAATTAAACAATGGATGAAGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008745251 6:54662031-54662053 CCTGATTTAAAAATGGGTAAAGG - Intergenic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009964272 6:70562361-70562383 CTGGACTTAAAACTGGATGAGGG - Intergenic
1010436052 6:75832408-75832430 CTGGAAAAAAAAATACATAATGG - Intronic
1010598661 6:77797071-77797093 CAAGAATAAAAAATGGTTAAAGG + Intronic
1010704437 6:79090278-79090300 CTGGGTCAAAAAAAGAATAAAGG - Intergenic
1010808259 6:80264878-80264900 GGGGATTAAAAAATGGAGAAAGG + Intronic
1010859731 6:80894542-80894564 CCTGATTAAAAAATGGACACAGG - Intergenic
1011102060 6:83733405-83733427 CTCCATTAAAAAGTGGGTAAAGG - Intergenic
1011368481 6:86606416-86606438 CTCGATTTAAAAATGGGCAAAGG + Intergenic
1011606628 6:89112741-89112763 CTATATTAAAAAATGAAAAAAGG - Intronic
1011872028 6:91907475-91907497 CTGGATTAAGCAATGGCTTAAGG + Intergenic
1012128424 6:95459332-95459354 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1012230264 6:96752538-96752560 ATGGAGTAAAAGATGGCTAAGGG - Intergenic
1012481186 6:99669105-99669127 ATGGTTTAAAAAATGAGTAAAGG + Intergenic
1012989815 6:105913710-105913732 CTTCATTAAAAAGTGGATAAAGG - Intergenic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013182131 6:107726584-107726606 CCCGATTTTAAAATGGATAAAGG + Intronic
1013197098 6:107854099-107854121 CCTGATTAAAAAATGGGTAAAGG - Intergenic
1013515357 6:110880217-110880239 AGTGATTAAAAAATGGACAAAGG - Intronic
1013690477 6:112636262-112636284 GTGGTTTAAAAGATGGATCACGG - Intergenic
1013848757 6:114487626-114487648 ATCCATTAAAAAATGGACAAAGG - Intergenic
1013943958 6:115700065-115700087 CTTGATTTAAAAATGGATAAAGG - Intergenic
1014034029 6:116744593-116744615 CCCAATTAAAAAATGGACAAAGG - Intergenic
1014716814 6:124875315-124875337 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1014792969 6:125695510-125695532 CCTGATTTAAAAATGGGTAAAGG - Intergenic
1014878871 6:126696740-126696762 ATGGATGAAAAAATTGAAAAAGG - Intergenic
1015284276 6:131467251-131467273 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1015433473 6:133157602-133157624 CTGGCTAGAAAAATGGTTAATGG + Intergenic
1015806168 6:137111067-137111089 CTTGATTAAAAAGTGGGCAAAGG + Intergenic
1015819109 6:137241216-137241238 CTTTATCAAAAACTGGATAATGG + Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1015927668 6:138326440-138326462 CTCCATTAAAAAGTGGGTAAAGG + Intronic
1016113276 6:140252483-140252505 ATGGAATAAGAAATGGATATAGG + Intergenic
1016613473 6:146020618-146020640 CTGGTTGATAAAAAGGATAAAGG + Intergenic
1016679347 6:146810126-146810148 CTGGTTTTAAAAATGGGCAAAGG + Intronic
1016845855 6:148567709-148567731 CTGGAATAAAAAACCGAAAATGG + Intergenic
1017312774 6:152993228-152993250 CTGTGGTAAGAAATGGATAAAGG - Intronic
1017436325 6:154418985-154419007 CTGATTTTAAAAATGGGTAAAGG + Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018256709 6:161927517-161927539 TTGAATTAGAAAATGGCTAAGGG + Intronic
1018333126 6:162754306-162754328 CCTGATTAAAAATTGGACAAAGG - Intronic
1018730172 6:166644138-166644160 CTGGCTTAAAAAGAGGAAAAGGG - Intronic
1019096452 6:169584728-169584750 CCTGATTAAAAAATGAGTAAAGG - Intronic
1019616383 7:1964826-1964848 CTGAACTAAAAGATGCATAATGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1020545543 7:9524637-9524659 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1020580850 7:9999160-9999182 CTCAAATAAAAAATGAATAAAGG + Intergenic
1020606967 7:10351242-10351264 CTTCATTAAAAAGTGGACAAAGG - Intergenic
1020790255 7:12618443-12618465 ATATATTAAAGAATGGATAAAGG - Intronic
1020843295 7:13249165-13249187 TTTGATTAAAAAATGGGCAAAGG - Intergenic
1020960084 7:14791454-14791476 TTGAATTGAAAAAGGGATAATGG + Intronic
1021014007 7:15509730-15509752 CCTGATTAAAAAATGGGCAAAGG + Intronic
1021094129 7:16515854-16515876 CTCAACTAAAAAATGGGTAAAGG + Intronic
1021291171 7:18847286-18847308 CTTGTTTAAAAAATGGAAATTGG - Intronic
1021497119 7:21288155-21288177 CTTGATTTAAAAATGGGCAAAGG + Intergenic
1021606841 7:22416650-22416672 CTCAATAAAAAAATGGGTAAAGG + Intergenic
1022010157 7:26301811-26301833 CTGGAAAAAAAAATGGGTATGGG - Intronic
1022052643 7:26692950-26692972 ATAAATTAAAAAATGGATAAAGG + Intronic
1022172923 7:27846776-27846798 CTTGATTAAAAAATGGGCAAAGG - Intronic
1022553671 7:31269499-31269521 CTAGATTAAAAAGTAGATGAAGG - Intergenic
1022883442 7:34616013-34616035 ATGACTTAAAAAATGGAAAAAGG + Intergenic
1023517291 7:41014441-41014463 CTGGATTTAAAAAGTGAGAAGGG + Intergenic
1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG + Intronic
1023677851 7:42649532-42649554 TAGAATTAAAAAATGGCTAATGG - Intergenic
1024177251 7:46853211-46853233 CTTGGTTAAAAAATGGGAAATGG - Intergenic
1024847216 7:53660651-53660673 CTGGATCAAAAAATGACAAAGGG + Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1024877321 7:54040880-54040902 CTTGAATAAAAACTGGGTAAAGG - Intergenic
1025270240 7:57505097-57505119 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1026048673 7:66926196-66926218 AGGGATTAAAAAATGGGCAAGGG - Intronic
1026389860 7:69889393-69889415 CTTAATCAAAAAATGAATAATGG + Intronic
1026485992 7:70821877-70821899 CTCAATTTAAAAATGGGTAAAGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026813792 7:73492863-73492885 CTTCATTAAAAAAAGGAGAAAGG - Exonic
1027351785 7:77319215-77319237 CCAGATTAAAAAATGGGCAAGGG + Intronic
1027565227 7:79783483-79783505 CTCTATTTAAAAATAGATAAAGG - Intergenic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1028343487 7:89751769-89751791 CTTCATTAAAAAGTGGACAAAGG + Intergenic
1028474155 7:91235498-91235520 CTGTTTAAAAAAGTGGATAAGGG - Intergenic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1029925880 7:104316494-104316516 CCTGATTAAAAAATGGGTAAAGG + Intergenic
1029991838 7:104969462-104969484 CTGGTTTGAAAAATGGAAATGGG + Intergenic
1030023116 7:105294824-105294846 CAGGATTAGAAAATGACTAAGGG - Intronic
1030263874 7:107595718-107595740 TTGAATTAAAAAAAGAATAATGG + Intronic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1030377376 7:108769529-108769551 ATGGAGAAAAAAATGGATCAGGG + Intergenic
1030473082 7:109992360-109992382 CCCCATTAAAAAATGGATAAAGG - Intergenic
1030513724 7:110516453-110516475 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1030581364 7:111359730-111359752 AGAGATTAAAAAATGCATAATGG - Intronic
1031502653 7:122539301-122539323 CTGTATTAAAATATGGTGAAAGG - Intronic
1032242065 7:130170281-130170303 ATGGATTGAACAATAGATAATGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033421374 7:141207609-141207631 CCTGATTAAAAAATGGGGAAAGG - Intronic
1033869904 7:145739440-145739462 CTTGATTAGAAAATGGGCAAAGG - Intergenic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034173818 7:149084626-149084648 CTGCATTAAAAAATGGGCAAAGG - Intronic
1034606684 7:152322833-152322855 CCTGATTAAAAAATGGGCAAAGG + Intronic
1034953813 7:155320288-155320310 CTGATTTAAAAAATGGGTAAAGG - Intergenic
1035451272 7:158978543-158978565 CTCGATTCAAAAATGGTCAAAGG - Intergenic
1035550552 8:520766-520788 CCTGATTAAAAAATGGGCAATGG - Intronic
1035695211 8:1590902-1590924 GTGGCTTAAAGAATGGTTAAGGG - Intronic
1036838342 8:12093969-12093991 CTGGCTTTGAAAATGGATGAAGG + Intergenic
1036860132 8:12340217-12340239 CTGGCTTTGAAAATGGATGAAGG + Intergenic
1036981028 8:13470434-13470456 CCTCATTAAAAAATGGACAAAGG + Intronic
1037468771 8:19186565-19186587 CTGGGTTAAAGAATCAATAAAGG - Intergenic
1037841400 8:22247834-22247856 CTGGAAAAAAGAATGGATTAAGG - Intronic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1038831901 8:31071339-31071361 CTAGAATAAAAAACGGATATAGG + Intronic
1039168847 8:34717693-34717715 CTTCATTAAAAAATGGGCAAAGG - Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039398085 8:37244451-37244473 CTGTATTAAAAAATGGGCAGGGG - Intergenic
1040862209 8:52010910-52010932 CTGGATTAAAAAATGCTATAAGG - Intergenic
1041046335 8:53890409-53890431 ATGAATAAAAAAATGGATACAGG - Intronic
1041140695 8:54816227-54816249 CTGCATTCTAAAATGCATAAAGG + Intergenic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041560291 8:59209914-59209936 CTCAATTAAAACATGGGTAAAGG - Intergenic
1042493997 8:69435644-69435666 CCTGATTAAAAAATGGGCAAAGG + Intergenic
1042626450 8:70763148-70763170 GTGGACTATAAAATGGATTAAGG + Intronic
1042670342 8:71255882-71255904 CTGATTTAAAAAATGGGAAAAGG + Intronic
1042708176 8:71684629-71684651 CTCCATTAAAAAATGGGAAAAGG - Intergenic
1043230528 8:77794666-77794688 TTGAAATAAAAAATGGATTATGG + Intergenic
1043307376 8:78812718-78812740 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1043546876 8:81325338-81325360 CTCCATTAAAAAGTGGGTAAGGG - Intergenic
1043551304 8:81376027-81376049 CTGGTTTAATAAACAGATAATGG - Intergenic
1043675149 8:82942136-82942158 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
1043754984 8:83992145-83992167 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1044086583 8:87949797-87949819 CCCCATTAAAAAATGGACAAAGG + Intergenic
1044114507 8:88318398-88318420 CTGGACTAAAAACTGAATAAGGG - Intronic
1044168264 8:89016774-89016796 CTGCATTAAAAATTGGGCAAAGG + Intergenic
1044204246 8:89473729-89473751 ATGGATTAAAAAAGGGGAAAAGG - Intergenic
1044346782 8:91113881-91113903 CCTGATTTAAAAATGGGTAAAGG + Intronic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045043938 8:98256467-98256489 CCTGATTAAAAAATGGGCAAAGG + Intronic
1045364745 8:101465322-101465344 CCAGATTCAAAAATGGAGAAAGG + Intergenic
1045773045 8:105767640-105767662 TTTGATTAGAAAATGGGTAAAGG + Intronic
1045856917 8:106774976-106774998 CTTCATTAAAAAATAGACAAAGG - Intergenic
1045967768 8:108045245-108045267 CTCCATTAAAAAATGGGCAAAGG + Intronic
1045987873 8:108270583-108270605 CCTGATTAAAAAATGGGCAAAGG - Intronic
1046024707 8:108708253-108708275 CTGGATTAAAAAAAAAAAAAAGG - Intronic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046174113 8:110552618-110552640 CAAGATTTAAAAATGGATAAAGG + Intergenic
1046223780 8:111249817-111249839 CCCCATTAAAAAGTGGATAAAGG + Intergenic
1046399760 8:113689752-113689774 CTCATTTAAAAAATGGATGAAGG - Intergenic
1046571571 8:115972740-115972762 CTGGAAGAAAAAATGGATTCAGG + Intergenic
1046677010 8:117120799-117120821 CTGGTTTAAAAAAGGGGCAAAGG + Intronic
1046684744 8:117212628-117212650 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1046701972 8:117411300-117411322 CCGCATTAAAAAATGGCCAAAGG + Intergenic
1046862053 8:119104497-119104519 TAGCATTAAAAAATGGACAAGGG - Intronic
1047081214 8:121462998-121463020 CTCGATTAAAAAATAGGCAAAGG + Intergenic
1047356323 8:124125548-124125570 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
1047893640 8:129341292-129341314 ATGGATTCAAAAAAGGTTAACGG + Intergenic
1048111732 8:131474782-131474804 ATAGATTAAAAAATTAATAAAGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050672076 9:8008580-8008602 CTGGATTAAAAAATGAGCAAAGG - Intergenic
1050673186 9:8021122-8021144 GTGGATTAAATAAGTGATAAAGG - Intergenic
1051040571 9:12804750-12804772 CAGGATGAAAAGATGGTTAAAGG + Intronic
1051188554 9:14486440-14486462 CTGGATTAAAAACTGCTAAAAGG + Intergenic
1051324622 9:15951689-15951711 CTGATTTAAAAAATGGGCAAAGG - Intronic
1051875818 9:21792130-21792152 CTGATTTAAAAAATGGGCAAAGG + Intergenic
1052005845 9:23347439-23347461 CTGATTTAAAAAATGGGTAAAGG + Intergenic
1052322030 9:27177789-27177811 CCTGATAAAAAAATGGACAAAGG - Intronic
1052617826 9:30865198-30865220 CTGTATTTAAAAATGTATATGGG - Intergenic
1052634127 9:31078886-31078908 GTGGATAAGAATATGGATAATGG + Intergenic
1052828908 9:33198978-33199000 CTGGATTAAAAAATTCCTAGAGG + Intergenic
1053231180 9:36411175-36411197 CCTGATTAAAAAATGGCAAAAGG + Intronic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053589939 9:39502345-39502367 CCTCATTAAAAAATGGAGAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053922198 9:43006629-43006651 CCTAATTAAAAAGTGGATAAAGG + Intergenic
1054383496 9:64520302-64520324 CCTAATTAAAAAGTGGATAAAGG + Intergenic
1054576361 9:66862946-66862968 CCTCATTAAAAAATGGAGAAAGG - Intronic
1054749211 9:68887163-68887185 GTGGAGAAAAAAATGGATCATGG - Intronic
1054987063 9:71274096-71274118 ATGGATGAACTAATGGATAAGGG - Intronic
1055009682 9:71551314-71551336 CTTGAATTAAAAATGTATAAAGG - Intergenic
1055222323 9:73951428-73951450 CTGCATTAATAAATGGGCAAAGG - Intergenic
1055531362 9:77187546-77187568 CCTGATTAAAAGATGGACAAAGG - Intronic
1056079702 9:83078873-83078895 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057458181 9:95233617-95233639 GTGGATGCAAAAATGGAAAATGG + Intronic
1057620408 9:96629654-96629676 CTGCATTTAAAAATGGAAAGAGG - Intergenic
1057622841 9:96652221-96652243 CCTGATTAAAAAATGGACAAAGG + Intronic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1058037442 9:100268224-100268246 CAGGATTAAAAAAAAGATTATGG + Intronic
1058192072 9:101930330-101930352 CTTGATTAAAATATGGGCAAAGG + Intergenic
1058319637 9:103612851-103612873 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1058644239 9:107115916-107115938 CTGGATTAGAAACTGGAAGATGG + Intergenic
1058916663 9:109573494-109573516 CTCTATTAAAAAATGGGCAAAGG + Intergenic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1186392356 X:9173718-9173740 CCCCATTAAAAAATGGACAAAGG + Intergenic
1186667293 X:11730717-11730739 CCTGATTAAAACATGGACAAAGG + Intergenic
1187037232 X:15553609-15553631 CCTGATTAAAAAATGAATAAAGG + Intronic
1187066219 X:15840867-15840889 AAACATTAAAAAATGGATAACGG + Intronic
1187326886 X:18299209-18299231 CTTAATTAAAAAGTGGACAAAGG + Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187804104 X:23099365-23099387 CTCCGTTAAAAAATGGATAAAGG + Intergenic
1188028086 X:25232389-25232411 CCCAATTAAAAAATGGGTAAAGG + Intergenic
1188550119 X:31354485-31354507 CTAGATTTAAAAATGTAAAACGG + Intronic
1189123295 X:38418307-38418329 CCTGATTAAAAAATGGGCAAAGG - Intronic
1189253168 X:39617031-39617053 CTGTACTAAAACATGGATACAGG + Intergenic
1190254106 X:48749612-48749634 CCCAATTCAAAAATGGATAAAGG + Intergenic
1190593551 X:52030103-52030125 CTGATTTAAAAAATAGGTAATGG + Intergenic
1190616190 X:52235312-52235334 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1190961418 X:55252959-55252981 CTGTTTTAAAAAATGGGCAATGG + Intronic
1191586439 X:62832299-62832321 CTTGATTAAAGAATGGGCAAAGG + Intergenic
1191756428 X:64597563-64597585 CTGCATCAAAAAGTGGGTAAAGG + Intergenic
1191822045 X:65321206-65321228 CTCAATTAAAAAGTGGACAAAGG + Intergenic
1191836827 X:65472208-65472230 CTCAATTTAAAAATGAATAAAGG - Intronic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192276752 X:69639585-69639607 CCTGATTAAAAAATGGACAAAGG - Intronic
1192353528 X:70378195-70378217 CTATATTAAAAAATGCAGAAAGG + Intronic
1192607378 X:72532692-72532714 CTCAATTGAAAAATGTATAAAGG - Intronic
1192731276 X:73804794-73804816 CTGTTTTAAGAAATGGAAAAAGG + Intergenic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1193017629 X:76753708-76753730 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1193516791 X:82475811-82475833 GTGTATTAAAAAATGGTAAAGGG - Intergenic
1193523747 X:82563194-82563216 CTCCATTAAAAAATGGTCAAAGG + Intergenic
1193622069 X:83765864-83765886 CCCCATTAAAAAATGGACAAAGG - Intergenic
1193837025 X:86355855-86355877 CCCCATTAAAAAATGGACAAAGG - Intronic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1194018334 X:88655212-88655234 CTTGATTAAAAATGGGTTAAAGG + Intergenic
1194151735 X:90333325-90333347 CTTGATTAAAAAATGGGCCAAGG + Intergenic
1194238384 X:91413129-91413151 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1194331753 X:92591570-92591592 CTGGAGCAAAAACTAGATAAAGG + Intronic
1195012836 X:100750308-100750330 CTGATTAAAAAAATGGGTAAAGG - Intergenic
1195124209 X:101789060-101789082 CCTGATTAAAAAATGGGCAAAGG - Intergenic
1195209839 X:102643646-102643668 CAGGATTAAAAAATGGGCTAAGG - Intergenic
1195368947 X:104154156-104154178 CCTGATTAACAAATGGACAAAGG + Intronic
1195647196 X:107245698-107245720 CTGGATTAAGAAATGCCTAGAGG - Intergenic
1195700543 X:107702341-107702363 ATGGGTTAAAATATGGATATAGG + Intergenic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1196029293 X:111077973-111077995 CCCAATTAAAAAATGGAAAAAGG + Intronic
1196201250 X:112888028-112888050 CTGGGTTTTAAAATGGATATTGG - Intergenic
1196213013 X:113016557-113016579 CTGGATAATAAAATATATAAAGG - Intergenic
1197285452 X:124589802-124589824 CTAGATTAAAAAATAAAAAAGGG - Intronic
1197299267 X:124758205-124758227 CTTGATTAAAAAATGGGCAAAGG + Intronic
1197522604 X:127519132-127519154 CTACATTAAAAACTGGAAAAAGG - Intergenic
1197529797 X:127609736-127609758 CTGGATTAGAAAATGTTAAATGG + Intergenic
1198152921 X:133928757-133928779 CTTGATTTAAAAATGGGCAAAGG - Intronic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1198809837 X:140524242-140524264 CTGAATTAAATAGTGGAGAAAGG - Intergenic
1199069195 X:143456775-143456797 ATGAATTAAACAAGGGATAATGG + Intergenic
1199205873 X:145147300-145147322 CCCAATTAAAAAATGGACAAAGG - Intergenic
1199410467 X:147516710-147516732 CATGATTAAAAAATGGGCAAAGG - Intergenic
1199913390 X:152312799-152312821 CTCCATTAAAAAATGGGAAAAGG + Intronic
1200291891 X:154883428-154883450 CCGAATTAAAAAATGGGCAAAGG + Intronic
1200338729 X:155379165-155379187 CCGAATTAAAAAATGGGCAAAGG + Intergenic
1200347740 X:155461527-155461549 CCGAATTAAAAAATGGGCAAAGG - Intergenic
1200498096 Y:3910092-3910114 CTTGATTAAAAAATGGGCCAAGG + Intergenic
1200640459 Y:5710629-5710651 CTGGAGCAAAAACTAGATAAAGG + Intronic
1201375242 Y:13312048-13312070 CCGCACTAAAAAATGGACAAAGG + Intronic
1201392220 Y:13511220-13511242 ATGAATTAAAAAATGCGTAAAGG + Intergenic
1201450761 Y:14111313-14111335 CTTTCTTAAAAAATGGAGAAAGG - Intergenic
1201538538 Y:15080207-15080229 ATGTAGTTAAAAATGGATAACGG + Intergenic
1201687900 Y:16727622-16727644 ATGGATTAAAAAATTAAAAAAGG - Intergenic
1202142960 Y:21747374-21747396 CTTGATGAAAAAATGAAAAAGGG + Intergenic
1202143898 Y:21758244-21758266 CTTGATGAAAAAATGAAAAAGGG - Intergenic