ID: 959630197

View in Genome Browser
Species Human (GRCh38)
Location 3:108499039-108499061
Sequence TACTTTGACCTGCCCCAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959630196_959630197 -10 Left 959630196 3:108499026-108499048 CCACTGCTTCATGTACTTTGACC 0: 1
1: 0
2: 0
3: 13
4: 165
Right 959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 93
959630195_959630197 4 Left 959630195 3:108499012-108499034 CCATCTTTTAGTTTCCACTGCTT 0: 1
1: 0
2: 2
3: 37
4: 435
Right 959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 93
959630194_959630197 28 Left 959630194 3:108498988-108499010 CCTTTCTTATTTCTCTAAATGTC 0: 1
1: 0
2: 1
3: 55
4: 666
Right 959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 93
959630193_959630197 29 Left 959630193 3:108498987-108499009 CCCTTTCTTATTTCTCTAAATGT 0: 1
1: 0
2: 8
3: 114
4: 1038
Right 959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959630197 Original CRISPR TACTTTGACCTGCCCCAATC TGG Intronic
901766486 1:11503014-11503036 TACTTGGTTCTGCCCCAATTTGG - Intronic
909987150 1:82175001-82175023 TGCTCTGACCTGCTCCAGTCTGG - Intergenic
914935604 1:151976989-151977011 TGCTCTGTCCTGCCCCACTCTGG - Intergenic
916064974 1:161128977-161128999 TACTTTGACCTAGTTCAATCTGG + Intronic
917528476 1:175810969-175810991 TACTATGAACTGACCCCATCTGG + Intergenic
917804629 1:178602388-178602410 TACTTTGGCCTGGCTAAATCTGG + Intergenic
921512327 1:216047359-216047381 GACTTTGACCAGCCTCAATATGG - Intronic
1065053716 10:21821187-21821209 TCCTTTCACCTGCCCAAAGCAGG - Intronic
1065786227 10:29218167-29218189 TCTTCTGACCTGCCCCATTCTGG - Intergenic
1070334774 10:75445648-75445670 AACTCTGCCCTGCCCCAATCAGG - Intronic
1080451325 11:32381203-32381225 TCCTTTGACCTGCACAAGTCAGG - Intergenic
1088241718 11:107780056-107780078 TACTCTGACCTGCCTGAAACCGG - Intergenic
1088637293 11:111835039-111835061 AACTCTAACCAGCCCCAATCTGG + Intronic
1089172922 11:116527790-116527812 TCCTGGGACCTGCTCCAATCTGG + Intergenic
1089988923 11:122839577-122839599 TAATTTGACCTGCTCCAAAAAGG - Intronic
1090340109 11:126010451-126010473 TACTTCGTCCTGTCCCAAGCTGG - Exonic
1096327188 12:50674548-50674570 AACATTGACCTGCCCCCCTCGGG + Exonic
1101674648 12:106907028-106907050 TAATCTGAGCAGCCCCAATCAGG - Intergenic
1103336245 12:120192254-120192276 TTTTCTGACCTGCCCCAATTAGG + Intronic
1103487885 12:121295639-121295661 TACTTTTACCTTCCCCAGCCTGG - Intronic
1106379562 13:29223291-29223313 TCCTGTCACCTGCCCCAGTCTGG - Intronic
1107018853 13:35731224-35731246 TCCTTTCACCTGCCCCAAGGCGG - Intergenic
1108055723 13:46483182-46483204 TCCTTTGACCTGCCCAAGGCAGG + Intergenic
1110806069 13:79756076-79756098 TACTCTAAACTGCCACAATCTGG + Intergenic
1112592602 13:100777219-100777241 TTCTTTCACCTGGCCCAATCAGG - Intergenic
1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG + Intronic
1118800995 14:69189765-69189787 TACTTTCAACAGCCCCAAACGGG - Intergenic
1119722265 14:76899219-76899241 TCCCTTTACCTGCCACAATCTGG - Intergenic
1119924727 14:78482302-78482324 TCCTTTGATCTGCCCCATTGAGG + Intronic
1124391428 15:29262290-29262312 TTCTTTCATCTGCCCCAGTCAGG + Intronic
1126483327 15:49151949-49151971 CACTTTGTTCTTCCCCAATCTGG - Intronic
1127157826 15:56148391-56148413 TACTTTGACCTTTCACATTCTGG + Intronic
1127652614 15:61023940-61023962 TACTTTGATCAACCCCAATTTGG + Intronic
1133277124 16:4645778-4645800 TACTGGGACCTGCCCCAGTGTGG + Intronic
1134648857 16:15892478-15892500 ACCTCTGACCTGCCCCAAGCAGG + Intergenic
1135154586 16:20041525-20041547 CACTGTTACCTGCCCCACTCTGG + Intronic
1137062096 16:35800155-35800177 TACTTTGCTCTGCCCCACTTTGG + Intergenic
1149171630 17:53819168-53819190 AACTTTGACAAGCCCCAAACTGG + Intergenic
1149219472 17:54399517-54399539 TACTTTGACCTCCTCCCATGAGG - Intergenic
1156484637 18:37457043-37457065 TTCTGAGACCTGCCCCCATCTGG + Intronic
1159610036 18:70514550-70514572 CTCTTAAACCTGCCCCAATCTGG + Intergenic
1163832019 19:19551616-19551638 TTCTTTGAGCTGCACCATTCTGG - Intergenic
1164257002 19:23536231-23536253 TGCTTTGTGCTGCCCCACTCAGG + Intronic
1164700679 19:30281834-30281856 TACTCTGAGCTGCACCAAACTGG + Intronic
1168014266 19:53558645-53558667 TCCTTTCACCTGCCCAAAGCAGG - Intronic
1168677327 19:58288248-58288270 TATTTTGAGCTGCTCCAACCTGG - Intronic
927314190 2:21663342-21663364 TTTTCTGACCTGCTCCAATCTGG + Intergenic
928561003 2:32485024-32485046 TACTTTAATCTGCCCCACCCCGG + Intronic
929783690 2:44974063-44974085 GACTTTCACCTTCCCTAATCTGG - Intergenic
930128774 2:47826961-47826983 AGCTTTAACCTGCTCCAATCTGG + Intronic
932912049 2:75816879-75816901 TCCTTTATCCTGCCCCAGTCTGG - Intergenic
936122072 2:109755593-109755615 TACTTTGACCCAGCCCAACCTGG - Intergenic
936222622 2:110615881-110615903 TACTTTGACCCAGCCCAACCTGG + Intergenic
938467577 2:131533391-131533413 TGCTTTGAGCCACCCCAATCTGG + Exonic
942415748 2:175757624-175757646 TACTTTGACCTGCACTGATCAGG + Intergenic
945320456 2:208416464-208416486 TACTTTGACTTGCCCTACTATGG + Intronic
948666150 2:239535976-239535998 CACTTTTCCCTGCCCCAACCTGG + Intergenic
1170485430 20:16810891-16810913 TACTTTGAACTTCCCCAATACGG - Intergenic
1174506470 20:51020912-51020934 TGCTCAGATCTGCCCCAATCAGG + Intronic
1182748947 22:32626603-32626625 TCTGTTGACCTGCCCCAACCGGG + Intronic
951322406 3:21261719-21261741 TTTTTTGACATGGCCCAATCAGG + Intergenic
952081501 3:29763545-29763567 TAGTTTGAGAAGCCCCAATCTGG + Intronic
952868183 3:37872456-37872478 TTCTCTGACATGCCCCCATCAGG + Intronic
953545951 3:43863682-43863704 CACTTCCAACTGCCCCAATCTGG - Intergenic
955917006 3:63916507-63916529 TACTTTGACCAACTCCTATCAGG + Intronic
958526014 3:95260597-95260619 TACTTTGCCCTGTAACAATCAGG + Intergenic
959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG + Intronic
966096433 3:176209929-176209951 TTCTTTGACCTGCTCCAATAGGG - Intergenic
970157203 4:13153332-13153354 TACTTTGCAGTGCCCCAATAGGG + Intergenic
971612357 4:28742056-28742078 TAATTTCCCCTGCCCCAATTCGG + Intergenic
978646347 4:110936634-110936656 TTTTCTGACCTGCTCCAATCTGG - Intergenic
980814764 4:137930382-137930404 GATTTTGACCTTCCCCTATCAGG + Intergenic
983231903 4:165137374-165137396 AACTTTGCCCTACCCTAATCTGG + Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985819272 5:2148639-2148661 TCCTTTGTCTTGCCCCAAGCAGG + Intergenic
986830348 5:11570216-11570238 GTTTTTGACCTGCTCCAATCTGG + Intronic
994154626 5:96489264-96489286 TCCTTTGATCTGCCTCAATTTGG - Intergenic
995450176 5:112291539-112291561 TCCTTTCACCTGCCCCTAGCAGG + Intronic
1003356118 6:5372690-5372712 TACTTTGAACTGCTCAAATGTGG + Intronic
1007673869 6:43579179-43579201 TCCTTTCACCTGCCCAAAGCAGG + Intronic
1007875768 6:45099048-45099070 TACTTCAACCTGCCCCAACATGG + Intronic
1008371003 6:50730489-50730511 TACTTTGCTCTTCCCCAATGTGG - Intronic
1012971065 6:105731666-105731688 TAATTTGATCTGCCCCAAAGTGG - Intergenic
1017587882 6:155947066-155947088 AACTTTGCTCTGCCCCAAGCAGG - Intergenic
1020103319 7:5407599-5407621 GACTTTGTCTTGCTCCAATCAGG + Intronic
1029611073 7:101626834-101626856 TGCTTGGACCTGCCCCACTCGGG - Intronic
1033101013 7:138472075-138472097 TTGTTTAACCTACCCCAATCTGG - Intronic
1034279470 7:149842715-149842737 TGTTTTAACCTGCCCCAATCTGG + Intronic
1039946001 8:42129159-42129181 ATGTTTGACCAGCCCCAATCTGG - Intergenic
1043125514 8:76389688-76389710 AACTTTGACATACTCCAATCTGG + Intergenic
1054883054 9:70165225-70165247 TTCTTTGTCCTGCCTCAACCAGG + Intronic
1057035210 9:91807004-91807026 TCCTTTCACCTGCCCAAAGCAGG + Intronic
1057903003 9:98964139-98964161 TCCTTTGCCCTGCACCATTCTGG + Intronic
1062139640 9:134948744-134948766 TCCTTTCACCTGCCCCAAGGCGG + Intergenic
1062635031 9:137486161-137486183 TACTCTGACCTTGGCCAATCAGG - Intronic
1190760768 X:53436343-53436365 TTCTTTCACCTGCCCAACTCCGG + Intergenic
1193566052 X:83078362-83078384 TACCATGCCCTACCCCAATCTGG - Intergenic
1194950714 X:100122319-100122341 TAGTTGGACCTGACCTAATCAGG + Intergenic
1197162174 X:123336436-123336458 TAGTTTGACCTTGCCAAATCTGG - Intronic
1198409806 X:136355064-136355086 TCCTTTCACCTGCCCCAAGGCGG - Intronic
1200089513 X:153627766-153627788 GACTTTGACCTGGCCCAGTGGGG - Intergenic