ID: 959632915

View in Genome Browser
Species Human (GRCh38)
Location 3:108529188-108529210
Sequence AATTCTAGGCTGCTACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959632914_959632915 -10 Left 959632914 3:108529175-108529197 CCATCAAGAATAAAATTCTAGGC 0: 1
1: 0
2: 0
3: 25
4: 227
Right 959632915 3:108529188-108529210 AATTCTAGGCTGCTACTGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959632915 Original CRISPR AATTCTAGGCTGCTACTGTC AGG Intronic
903738100 1:25543336-25543358 AATCCTAGGCCGCTGCTCTCAGG + Intergenic
907820781 1:57966234-57966256 AATTCTTGGCAGCTTCTTTCAGG + Intronic
908649553 1:66317022-66317044 AATTCTTGTTTGCTACTGTGTGG + Intronic
910059584 1:83073192-83073214 AAATCTTGGCTCTTACTGTCTGG - Intergenic
911814734 1:102332550-102332572 AAGTCTAGGCTGATGCTGTAAGG + Intergenic
919077008 1:192825926-192825948 AATTCTTTGCTGCTTCTTTCTGG - Intergenic
1067467480 10:46511621-46511643 CATTCTATTCTGCAACTGTCAGG + Intergenic
1067619706 10:47872984-47873006 CATTCTATTCTGCAACTGTCAGG - Intergenic
1067765841 10:49085595-49085617 AACTGTGGGCTGATACTGTCAGG + Intronic
1078291308 11:10012839-10012861 AATGTTAGGCTGCTGATGTCTGG + Intronic
1082983039 11:59141977-59141999 AATTATTGGCTGCTATTGTTTGG + Intergenic
1083566868 11:63726456-63726478 AATTTTAGGCTGTCACTCTCTGG - Intronic
1085679384 11:78557561-78557583 GATCCTAGGCTCCTACAGTCAGG - Intronic
1093859507 12:24146165-24146187 AAATATATGCTGCTACTGTTGGG - Intergenic
1093970656 12:25372789-25372811 AATTCTGTGCTGTTACTGTCTGG - Intergenic
1094263651 12:28529319-28529341 AACTCTAGGCTACATCTGTCTGG - Intronic
1098980247 12:76948139-76948161 CCTTCTAGCCTACTACTGTCCGG - Intergenic
1102453915 12:113059624-113059646 ATTTCTAGGCTGCTTCTGCACGG - Intronic
1105638458 13:22239069-22239091 GACTCTAGGTTGCTACAGTCAGG - Intergenic
1108793700 13:54004750-54004772 AATTCTAGGCAGCTATTAACAGG + Intergenic
1108846887 13:54689333-54689355 AATTCTAGGCTACCTTTGTCAGG + Intergenic
1109700217 13:66015225-66015247 AATTCTATGCAGTTACTTTCAGG - Intergenic
1109776677 13:67050054-67050076 AATCCCAGGCTGATACTGTGTGG + Intronic
1111746567 13:92278024-92278046 AATTTTAGGCTATTACTCTCTGG + Intronic
1116426126 14:44794043-44794065 AATTCAAGGCTTTTTCTGTCTGG - Intergenic
1116838767 14:49797712-49797734 AGTTCTAGGGTGATATTGTCAGG - Intronic
1119560756 14:75587636-75587658 AATTCCAGGCTGTTACTACCTGG - Intronic
1121773599 14:96574944-96574966 AATAAAAGGCAGCTACTGTCAGG - Intergenic
1122951361 14:105046978-105047000 AATTCTGGGATCCTACTGCCTGG - Intergenic
1126832762 15:52625209-52625231 AATTCTAGTTTGCTATTGCCTGG - Intronic
1134094121 16:11407603-11407625 AATTCTTGGCTGCTGGTGCCAGG - Intronic
1136070065 16:27782329-27782351 ACTCCCAGGCTGCCACTGTCAGG + Intergenic
1137632207 16:49954943-49954965 CATTCTAGGCTAGTGCTGTCCGG - Intergenic
1141248907 16:82337129-82337151 AACTCTAGCCTGCTAATTTCGGG + Intergenic
1148543769 17:48501408-48501430 AGCTCTAGGCTGCTTCTTTCTGG - Intergenic
1151885038 17:76918452-76918474 AACTCTGGGCTGCTTCTGTTGGG + Intronic
1152338347 17:79710247-79710269 AATGCTAGGGTGCCAGTGTCAGG - Intergenic
1155107468 18:22681832-22681854 AATTCTTGGGTCCTACTGACTGG - Intergenic
1157607813 18:48937224-48937246 AAGTCTACGCAGCTACAGTCAGG + Intronic
1163863639 19:19755273-19755295 ACTTCTAGGCCGCCACTGACTGG + Intergenic
1164573509 19:29391270-29391292 TGTTGTAGGCTGCTACTGTTAGG - Intergenic
1166182684 19:41120085-41120107 CACTCTGGGCTGTTACTGTCTGG - Intronic
1166674592 19:44732302-44732324 CATTCTGGGATGCGACTGTCTGG - Intergenic
925503526 2:4534078-4534100 AATTCAAGGCTGCTACCATGGGG - Intergenic
928505784 2:31951263-31951285 AATTTTAAGTTGCTACTGACTGG + Intronic
929651194 2:43681363-43681385 ACTTCTTGGCTGCTACTGGAAGG + Intronic
936977384 2:118233116-118233138 AATTCGAGGCTGGTTCTGTTTGG + Intergenic
940608008 2:155952521-155952543 CATTCCAAGCTGCTCCTGTCAGG - Intergenic
943192001 2:184689348-184689370 AACACTAGACTGCTAATGTCAGG - Intronic
944906924 2:204270941-204270963 AATTCTAAACTACTACTGTCTGG - Intergenic
1175599094 20:60258147-60258169 GAATCAAGGCTGCTACTGTAAGG + Intergenic
1180666359 22:17515969-17515991 AATTTAAGGCTGGTACTGGCCGG - Intronic
954783945 3:53079750-53079772 AATTCAAAGCTGCTTCTGGCAGG + Intronic
959632915 3:108529188-108529210 AATTCTAGGCTGCTACTGTCAGG + Intronic
962505114 3:136038983-136039005 AATAAGAGGCTGCTACTGCCAGG - Intronic
964856812 3:161154720-161154742 AATTCTAGGCTTATTCTTTCTGG + Intronic
975279769 4:72547641-72547663 AATACTAGTCTGGTACTGACTGG - Intronic
975303379 4:72818528-72818550 AATTTTAAGCAGCTACTGTGAGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
982532154 4:156558549-156558571 AATTGTGGGCTGCCACTGCCAGG - Intergenic
991111885 5:62909694-62909716 AATTCTATGCTGTTACTCTGAGG + Intergenic
992608603 5:78487888-78487910 AATGCCATTCTGCTACTGTCGGG + Exonic
995254490 5:110030745-110030767 AATTCTAGGTTGCTATGCTCAGG - Intergenic
995973692 5:118004860-118004882 AATTCTACGTTGATACTGTAAGG + Intergenic
999231492 5:150064791-150064813 AATCCTAGGCTCCTAATTTCTGG + Intronic
1000293193 5:159890292-159890314 AATTCTTGGCTGCTATTGGAAGG - Intergenic
1008668274 6:53739224-53739246 AATTCTAGTCTGCTCTTGTTGGG - Intergenic
1014510529 6:122316134-122316156 AAATCTAGGCTTCATCTGTCAGG - Intergenic
1017908768 6:158774994-158775016 AACTCTTGGCTGCTACTCTGTGG - Intronic
1040938392 8:52805875-52805897 AATTCTACAGTTCTACTGTCTGG - Intergenic
1045195197 8:99923551-99923573 ATTTCTAGGCTCCTTCTGTGAGG - Intergenic
1055119046 9:72637015-72637037 AGTTCTAGGCTGCTTCTCTAGGG - Intronic
1055216091 9:73864139-73864161 TATTCTTGACTGTTACTGTCTGG - Intergenic
1058823785 9:108756862-108756884 AGTTGTAGGCTGCTACAGTCTGG - Intergenic
1061403476 9:130381268-130381290 AATTCTAGGCTGGGGCTGGCCGG - Intronic
1186709802 X:12181717-12181739 AATACTGTGCTGCCACTGTCTGG - Intronic
1196029802 X:111084572-111084594 ACTTCTAGACTGCTACTTTGGGG + Intronic