ID: 959633624

View in Genome Browser
Species Human (GRCh38)
Location 3:108536678-108536700
Sequence CAGTGACAAAAGAGTAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959633620_959633624 25 Left 959633620 3:108536630-108536652 CCAGGTGGCCATAATGAAAGTAA No data
Right 959633624 3:108536678-108536700 CAGTGACAAAAGAGTAAGTGGGG No data
959633619_959633624 26 Left 959633619 3:108536629-108536651 CCCAGGTGGCCATAATGAAAGTA No data
Right 959633624 3:108536678-108536700 CAGTGACAAAAGAGTAAGTGGGG No data
959633621_959633624 17 Left 959633621 3:108536638-108536660 CCATAATGAAAGTAAGTATACAA No data
Right 959633624 3:108536678-108536700 CAGTGACAAAAGAGTAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959633624 Original CRISPR CAGTGACAAAAGAGTAAGTG GGG Intergenic
No off target data available for this crispr