ID: 959634566

View in Genome Browser
Species Human (GRCh38)
Location 3:108549688-108549710
Sequence CACTTTTAGCCACTGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959634562_959634566 0 Left 959634562 3:108549665-108549687 CCAAATTTCAAGTGCTCAATGGC 0: 1
1: 12
2: 171
3: 663
4: 1437
Right 959634566 3:108549688-108549710 CACTTTTAGCCACTGGCTATGGG 0: 1
1: 0
2: 2
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959634566 Original CRISPR CACTTTTAGCCACTGGCTAT GGG Intergenic
902750429 1:18505390-18505412 CACATCTAGCTACAGGCTATGGG - Intergenic
905120316 1:35676797-35676819 CACTTTTAGCCTGTTCCTATTGG - Intergenic
906060773 1:42947106-42947128 CAGTTCTAGCCACTGGCTGGTGG - Intronic
915092282 1:153434919-153434941 CACCATTTGTCACTGGCTATAGG - Intergenic
916380634 1:164207069-164207091 CACTCTCAGCCCTTGGCTATAGG - Intergenic
918126328 1:181587386-181587408 CACATTCAGCCACTGAATATGGG + Intronic
921530238 1:216273264-216273286 CTCTTGCAGTCACTGGCTATTGG - Intronic
1063645851 10:7882632-7882654 CACCTTTAGACACTGACTGTTGG - Intronic
1064590975 10:16890474-16890496 CCCTGCTAGCCACTGGCTGTGGG - Exonic
1066024675 10:31343059-31343081 AATCTTTAGCCACTGGCTAGTGG + Intronic
1066366943 10:34786348-34786370 CACTTTTAGTCAATAGTTATGGG - Intronic
1067328243 10:45290472-45290494 CAGTTTTATCCAATGGGTATTGG - Intergenic
1067666447 10:48283520-48283542 CACTTTTAGCCCCAGGCCATGGG - Intergenic
1069070397 10:63985951-63985973 CCCATTTAGCCACTGACTTTGGG - Intergenic
1075428935 10:122364578-122364600 AACTTTGAGCCACCGGCTAAAGG - Intergenic
1075572125 10:123553691-123553713 CATTTTAAGCCACTGGATTTTGG + Intergenic
1076493137 10:130877471-130877493 CACTTGTGGGCACTGGCTAATGG + Intergenic
1076767891 10:132646549-132646571 CACTATTAGCAACAGCCTATAGG - Intronic
1077889856 11:6411132-6411154 CTCTTTTAGCCACTTGGCATTGG + Exonic
1078101179 11:8331213-8331235 CACTAGTAGCCACTAGATATAGG + Intergenic
1079811617 11:25004627-25004649 CACTTTCCTCGACTGGCTATGGG - Intronic
1080885513 11:36363952-36363974 CATTTTTAGCCACTGGTCTTGGG + Intronic
1083625367 11:64069476-64069498 CCCCTTTAGCCTCTGGCTCTGGG + Intronic
1085696787 11:78711665-78711687 CACTGTAAATCACTGGCTATAGG + Intronic
1085723824 11:78936589-78936611 CACTTTTCTGCACTAGCTATGGG + Intronic
1086928789 11:92669746-92669768 CACTTCTAGCCACAGGCCCTGGG + Intronic
1087659737 11:100973033-100973055 TACTTTTAGCCACTTCCAATTGG - Intronic
1088196402 11:107278771-107278793 CACTTTGAACCACTGGCTGTGGG + Intergenic
1090067931 11:123519250-123519272 CACTATTAGTCACTGGCTCTGGG - Intergenic
1090372568 11:126266969-126266991 GACTTTTAGCCATTGTCTAGTGG - Intronic
1091550836 12:1533828-1533850 CAGTTTGAGCCACTGGCTTGCGG + Intronic
1094032583 12:26029760-26029782 CAGTTTTACCCACTGGTTAAAGG + Intronic
1097131259 12:56812123-56812145 CACTTTCACCCACTGACTGTGGG + Intergenic
1098881333 12:75920351-75920373 AACTTTTACCCACTTGCTTTTGG - Intergenic
1106928792 13:34641193-34641215 CTCTTTTAGGGACTGGCTTTTGG - Intergenic
1108536717 13:51388772-51388794 TCCTTATATCCACTGGCTATTGG + Intronic
1109110673 13:58315602-58315624 CAATTTTTGCTACTGGATATTGG - Intergenic
1116977077 14:51128610-51128632 CATTTATAGGCAATGGCTATGGG + Intergenic
1118393088 14:65312865-65312887 AACTTTTAGTCATTGGCTAAAGG + Intergenic
1125886996 15:43236592-43236614 CACTTTTATCCCCTTGCTCTGGG + Intronic
1126317872 15:47390070-47390092 CACTTTAAGCCACTGAGTTTTGG - Intronic
1127824647 15:62692260-62692282 CTCTTTAAGCCACTGGCTAGAGG + Intronic
1128334841 15:66779236-66779258 CACTATTGCCCACTGGCTAAGGG + Intronic
1132840362 16:1975881-1975903 CACTTTTAGGCAGGGGCTATTGG - Exonic
1133514166 16:6491750-6491772 CCCTTTTAGTCACTAGCTGTTGG - Intronic
1134864030 16:17588776-17588798 CACTTTTTGCCTCTGGATGTTGG - Intergenic
1139308677 16:66009853-66009875 CACTTTTACCACCTAGCTATAGG + Intergenic
1140906026 16:79409841-79409863 CACGTTTGGCTAGTGGCTATGGG - Intergenic
1144088651 17:11833620-11833642 CATTTGGAGCCACTTGCTATAGG + Intronic
1149874870 17:60222110-60222132 AACTTTTTGGCACTGGCTCTTGG + Intronic
1150371115 17:64638929-64638951 CACTTTTGGGGTCTGGCTATGGG - Intronic
1159476840 18:68931794-68931816 GAGTTTTAGCCAATGGATATGGG - Intronic
1165635579 19:37337016-37337038 CACTTTCAGCTTCTGGCAATTGG + Intronic
1167735433 19:51291744-51291766 TACTTTGAGCCTCTGGCTATTGG - Intergenic
926892133 2:17648057-17648079 CATTTTAAGCCACTAGCTTTTGG + Intronic
929440120 2:41959134-41959156 CACTTCTATCCACTTTCTATGGG - Intergenic
929882764 2:45851697-45851719 CTCTTGTAGCCTCTGGCCATGGG - Intronic
930816429 2:55602763-55602785 CACCTTTTCCCACTGGTTATTGG + Intronic
930886209 2:56330084-56330106 CACTTTTATCCTCTGGCATTAGG + Intronic
932752146 2:74378108-74378130 CACTGTTTGCCACTGGCAAATGG - Exonic
933351003 2:81152088-81152110 CATTTTTAGCCAATGGCTATTGG + Intergenic
937035925 2:118781824-118781846 CAGATTTAGCCTCTGGCTCTGGG - Intergenic
940368352 2:152873847-152873869 CAATATTAGCCACAGGCTAGTGG + Intergenic
942847816 2:180447065-180447087 CACTTTATGCCACAAGCTATTGG + Intergenic
1170445722 20:16425512-16425534 CACTTTCACCCACTGGTTTTAGG - Intronic
1170963992 20:21050321-21050343 CATTTTTATCCACTAGATATAGG + Intergenic
1175642285 20:60640941-60640963 CACTTGTTGCCACTGCCCATGGG - Intergenic
1176662102 21:9646765-9646787 CATTTTTAGCCACAAGTTATGGG - Intergenic
1178154963 21:29841674-29841696 CACTATATGCCACTGTCTATTGG + Intronic
951499231 3:23365367-23365389 AACTTTTGGGCAGTGGCTATGGG - Intronic
953688666 3:45098522-45098544 CAGTTTCAGGCACTGTCTATTGG + Intronic
957699201 3:83687334-83687356 CAATTTTAGTCCCTGGCTTTTGG - Intergenic
957702436 3:83733950-83733972 GACTTTTGGCCACTTGCCATAGG - Intergenic
959634566 3:108549688-108549710 CACTTTTAGCCACTGGCTATGGG + Intergenic
961414046 3:126744572-126744594 CACTTTAAGCCACTGCCAACTGG - Intronic
961629072 3:128283107-128283129 CCCTTTCAGGCACTGGCTTTGGG + Intronic
963863349 3:150333345-150333367 AACTTTAAGCCAATGGCCATTGG + Intergenic
973015294 4:45130196-45130218 CACCTTTGGCCACTGGATCTAGG + Intergenic
979351180 4:119646139-119646161 CTCCTTTACCCTCTGGCTATTGG + Intergenic
982654159 4:158125598-158125620 CACTTTTACTCACTGTCTCTGGG - Exonic
985413292 4:189709752-189709774 CATTTTTAGCCACAAGTTATGGG + Intergenic
985571910 5:651563-651585 CACCTTTACTCCCTGGCTATAGG + Intronic
987145069 5:14983924-14983946 TAATTCTAGCTACTGGCTATGGG - Intergenic
988176072 5:27727339-27727361 AACTTTTAGACACTGACTCTAGG + Intergenic
989800051 5:45526399-45526421 CAGTTTCAGCCACTGGCCTTCGG + Intronic
990182794 5:53181165-53181187 CATTTTTAGCCACTGTCTCATGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
990922132 5:60979366-60979388 CACTTTTAGGCCCTGGCTCCTGG + Intronic
992064067 5:73087700-73087722 AACTTGTGGGCACTGGCTATAGG + Exonic
992830517 5:80589197-80589219 CACTTCTACTCACTGTCTATTGG - Intergenic
995325125 5:110881466-110881488 CACTTTTTGCTGATGGCTATGGG + Intergenic
996403181 5:123084988-123085010 CTGCTTTAGCCACTGGCTATAGG + Intergenic
997081260 5:130741419-130741441 CACCTTAAGACACTGGCCATTGG + Intergenic
1009412137 6:63378320-63378342 CACTTCTACCCACAGCCTATTGG + Intergenic
1009667252 6:66699977-66699999 CACTTTTAACAGCAGGCTATGGG + Intergenic
1013097352 6:106957709-106957731 CTCTTTTGGCCTCTGGCTACTGG - Intergenic
1017883194 6:158576244-158576266 CACATTTAGCCGCCTGCTATAGG - Intronic
1019509143 7:1408533-1408555 CTCTTTGGGCCACTGCCTATGGG - Intergenic
1024113515 7:46171077-46171099 CACATGTAGCCAGTGGCTAGAGG - Intergenic
1026228723 7:68465070-68465092 CACCTTTAGCCATTGCCTAAGGG + Intergenic
1027948806 7:84785707-84785729 TACTTTTAGCAACTGGCAAGTGG - Intergenic
1028971207 7:96860271-96860293 CAATTTTAGTTATTGGCTATTGG + Intergenic
1029967468 7:104755044-104755066 CTCTTTAAGCCACTGAATATTGG - Intronic
1030093247 7:105876301-105876323 CACTTTTTCCCAGTGGCTCTAGG + Intronic
1032105108 7:129021402-129021424 CACTTATACTTACTGGCTATTGG - Intronic
1032203535 7:129841457-129841479 CACTTATGGCTAGTGGCTATTGG - Intronic
1032955713 7:136969800-136969822 CAATATTTCCCACTGGCTATGGG + Intronic
1034325337 7:150225534-150225556 CACTGTTTCCCACTGGCTACAGG - Intergenic
1034767866 7:153743714-153743736 CACTGTTTCCCACTGGCTACAGG + Intergenic
1034833223 7:154328112-154328134 TTCTTTTAGTCTCTGGCTATTGG - Intronic
1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG + Intronic
1035130581 7:156649584-156649606 CCCTTTTAGCCAGTTGCTACAGG + Intronic
1039251427 8:35669358-35669380 CACTGTTAGGTACTGACTATTGG - Intronic
1040673653 8:49722687-49722709 CAGTTATAGCCAGTGGCGATGGG + Intergenic
1042640040 8:70923706-70923728 CACTTTTAGTGTCTGGCTAAGGG + Intergenic
1043914897 8:85911047-85911069 CAGTTTTAACCCCTGTCTATTGG + Intergenic
1051841658 9:21404616-21404638 CAACTTTAGCCAATGGCTTTGGG - Intergenic
1052107663 9:24539101-24539123 CACTTTTACCCACAGTCCATTGG + Intergenic
1054863503 9:69976534-69976556 CCCTTTTAGAAACTGACTATGGG - Intergenic
1056381248 9:86059085-86059107 CATTCTTAGCCACTGTGTATTGG - Intronic
1058090694 9:100802372-100802394 GACTGTTACCCAATGGCTATGGG - Intergenic
1058322211 9:103647075-103647097 CAAATTAAGCCAATGGCTATAGG + Intergenic
1203639665 Un_KI270750v1:148608-148630 CATTTTTAGCCACAAGTTATGGG - Intergenic
1186339550 X:8629417-8629439 CACTTTATGCCACTTGCTACAGG + Intronic
1186747000 X:12580202-12580224 GAGTTTTAGCCACTGGACATGGG - Intronic
1187937018 X:24345987-24346009 CACTTTTTGCTGATGGCTATAGG - Intergenic
1189813816 X:44804947-44804969 CACATATAGCTAATGGCTATTGG - Intergenic
1191630992 X:63322082-63322104 CAATTTTAGCCTGTGGCTATAGG - Intergenic
1192888458 X:75362621-75362643 CACTCTTTGCTAATGGCTATGGG + Intergenic
1194109667 X:89817932-89817954 CACTTTTTGCTGATGGCTATGGG + Intergenic
1197936934 X:131749245-131749267 CACTCTTAGCCATTTGCTTTTGG + Intergenic
1197937601 X:131755537-131755559 CACTCTTAGCCATTTGCTTTTGG + Intergenic
1200147001 X:153931528-153931550 CACTTTTTTCCACTGTCTACTGG + Intronic
1200462334 Y:3472670-3472692 CACTTTTTGCTGATGGCTATGGG + Intergenic