ID: 959636792

View in Genome Browser
Species Human (GRCh38)
Location 3:108583602-108583624
Sequence GTGGTGATGGGAGGTGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 7, 3: 71, 4: 695}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959636784_959636792 7 Left 959636784 3:108583572-108583594 CCAGAGGCTGGGAAGAATATGGG 0: 2
1: 3
2: 49
3: 353
4: 2190
Right 959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG 0: 1
1: 0
2: 7
3: 71
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959636792 Original CRISPR GTGGTGATGGGAGGTGTGAG GGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900470903 1:2854458-2854480 CTGGTGGACGGAGGTGTGAGGGG + Intergenic
900520727 1:3104346-3104368 GTGCTGGTGGGAGCTGGGAGGGG + Intronic
900611353 1:3545901-3545923 GGGGTCAGGGGAGGTGGGAGGGG - Intronic
900926537 1:5709700-5709722 GGGAAGATGGGAGGTGGGAGGGG - Intergenic
900959582 1:5910403-5910425 GGGGTGACGGGAGGTGGGACAGG - Intronic
900969337 1:5980826-5980848 GTGGTGATGGGAGCTGGGCTTGG - Intronic
901136971 1:7003842-7003864 GAGGTAATAGGAGTTGTGAGAGG + Intronic
901836966 1:11930428-11930450 GTGGAGACGGGAGGTGGGTGGGG + Intergenic
902405709 1:16182221-16182243 AAGGTCATGGGAGGTGTGGGGGG + Intergenic
902838692 1:19062092-19062114 TTGGTGGTGGGAGCTGGGAGGGG - Intergenic
902900174 1:19509547-19509569 ATGGTGCTGGGTAGTGTGAGAGG + Intergenic
903012269 1:20339647-20339669 GTGGTGGTTGGAAGTGGGAGGGG - Intronic
903357507 1:22757116-22757138 GGGGTGATGGTGGGTGGGAGAGG + Intronic
903572193 1:24314122-24314144 GTGGTGGTGGGTGGGGTGGGGGG + Intergenic
903645895 1:24896397-24896419 ATGGTGATGGGAGGTGGGAGAGG - Intergenic
903858976 1:26354001-26354023 GTGGAGATGGGAGGGGAGACTGG - Intronic
904338037 1:29810532-29810554 GGGGTGATGGTAGGGGTGGGGGG + Intergenic
904363235 1:29991966-29991988 GTGGTTATTAGAGGAGTGAGGGG - Intergenic
904808896 1:33150720-33150742 GTGGGGTCGGGAGGTGGGAGTGG + Intronic
904921553 1:34012150-34012172 GTGGGGATGGGTGGGGAGAGAGG - Intronic
905025054 1:34844186-34844208 GTCCTGAGAGGAGGTGTGAGAGG - Intronic
905442856 1:38005741-38005763 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
905546930 1:38807531-38807553 CTGGAGATGGGAGGTTGGAGGGG - Intergenic
905905219 1:41613267-41613289 CTGGAGAGGGGAGCTGTGAGTGG - Intronic
906414000 1:45605134-45605156 GTAGTGATGGAAGTTGTGAATGG + Intronic
906634848 1:47402570-47402592 GTGGAGTTGGGAGCTGTGTGTGG - Intergenic
906637573 1:47419358-47419380 GTGGTGATGGAAGATGAGGGTGG + Intergenic
906655662 1:47546531-47546553 GTGGTGATGGCAGGTTTGTGTGG + Intergenic
906942919 1:50271865-50271887 GTGGGGGTGGGAGGTGGGAGCGG - Intergenic
907410495 1:54280088-54280110 ATGGTGGTGGGAGGAGAGAGAGG - Intronic
908880581 1:68727279-68727301 CTGGAGATGGGAGGAGGGAGAGG - Intergenic
909676812 1:78247783-78247805 GTGTTGATGTGAGGTATGTGTGG + Intergenic
909820473 1:80053608-80053630 GGGCTGATGGGGGGTGTGAGGGG + Intergenic
910701739 1:90082698-90082720 GTTGGGATGGGGTGTGTGAGGGG - Intergenic
911398519 1:97342866-97342888 GTGGTGATGGTAAGTGGTAGGGG - Intronic
912155352 1:106911914-106911936 ATGATGGTTGGAGGTGTGAGTGG + Intergenic
912273126 1:108230026-108230048 GTGGAGAGGGGAGGAGAGAGAGG - Intronic
912295094 1:108464296-108464318 GTGGAGAGGGGAGGAGAGAGAGG + Intronic
912395978 1:109344326-109344348 CTTGTGTTGGGAGCTGTGAGAGG - Intronic
912435544 1:109658608-109658630 GTGGTGATGGGAAGGCAGAGAGG - Intronic
912775826 1:112505959-112505981 GAGCTGAAGGGAGGGGTGAGGGG - Intronic
913161506 1:116150074-116150096 GAGGCGATGGGAGCTTTGAGAGG - Intergenic
915068343 1:153244654-153244676 GTGGTGATGGTGGGTGATAGTGG + Intergenic
915473648 1:156139890-156139912 GGGGTGCTGGGAGGAGGGAGAGG + Exonic
915728856 1:158038344-158038366 GTGGTGGTGGGAGGGGGCAGAGG + Intronic
916266286 1:162892623-162892645 GGGGTGAAGGGAGCTGTGTGGGG + Intergenic
916822209 1:168410461-168410483 GTGGTGGTGGGAGGTGCTTGTGG + Intergenic
917413558 1:174784472-174784494 ATTGTGGTGGGAGGTGGGAGAGG + Intronic
917970229 1:180201467-180201489 GTGGTGGAGGGAGGGGTGAAAGG - Exonic
918653082 1:186990131-186990153 GAGGAGATGGGATGTGTTAGAGG + Intergenic
919052060 1:192523654-192523676 GTGGTGATGGGAGGTTGTGGTGG - Intergenic
919834921 1:201567049-201567071 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
919921695 1:202169937-202169959 CAGGTGAAGGGAGGTGTGATGGG - Intergenic
920047588 1:203143469-203143491 GTGGTGGTGGGTGGGGGGAGGGG - Intronic
920279464 1:204831718-204831740 GTGGGGAGGGGAGAAGTGAGAGG + Intronic
920366286 1:205449949-205449971 GGGGTGAGTGGAGGAGTGAGTGG - Intronic
920374730 1:205501850-205501872 GTGCAGATGGGAGGTGGGAGGGG - Intergenic
920689231 1:208133053-208133075 GAGGAGATGAGAGGTCTGAGGGG - Intronic
920697518 1:208192542-208192564 GTGGAGTTGGGAGTTGGGAGTGG + Intronic
920779793 1:208978055-208978077 GTGATGATGGGAGTTGTATGTGG + Intergenic
920950166 1:210565057-210565079 CTGGAGATGGGAGGTGGGAAGGG + Intronic
921047649 1:211488851-211488873 GTGGTGAGTGGGGGTGAGAGTGG - Intronic
923021509 1:230167694-230167716 GTGGTGATGGGAGGAAGGGGCGG + Intronic
923203263 1:231733223-231733245 TTGGTGATGGTAGGTAGGAGTGG + Intronic
923520979 1:234734734-234734756 GTGGTTCGGGGAGGGGTGAGGGG + Intergenic
924073564 1:240308937-240308959 GTGGTTATGTTAGGTTTGAGTGG + Intronic
924258141 1:242202904-242202926 GCGGGGATGCCAGGTGTGAGAGG + Intronic
924610213 1:245567455-245567477 CTGGGGATGGGAGGGGTGAAGGG - Intronic
924700211 1:246443955-246443977 GTGGTGATGGGTGGTGAGGGAGG - Intronic
1062817927 10:514638-514660 GTGGTGAGGGTCGGTGTCAGGGG - Intronic
1063454917 10:6176282-6176304 GTGGTGATGGGAGGGGGCACGGG + Intronic
1064245222 10:13662581-13662603 GTGGTGATGGGGGTTGGGGGAGG + Intronic
1064727005 10:18290448-18290470 GAGGTGATGGGAGGTGACAGAGG - Intronic
1064889934 10:20159690-20159712 AAGGTGATGGGAGGTGGTAGGGG - Intronic
1065785159 10:29206099-29206121 GTGGTGATGGTATGAGGGAGTGG - Intergenic
1066408641 10:35144153-35144175 GTGGTGATGGGAGGTTACAGTGG + Intronic
1067065343 10:43101232-43101254 TTGGTAATGGGAGGGGTGGGGGG + Intronic
1067267356 10:44757369-44757391 GGAGAGATGGGAGGTGAGAGGGG - Intergenic
1067357587 10:45544956-45544978 AAGGTGCTGGGAGGTCTGAGGGG - Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1067777079 10:49171589-49171611 GTGGGAATGGCAGCTGTGAGGGG - Intronic
1067777592 10:49174704-49174726 GTGGTGGGGGGTGGTATGAGGGG + Intronic
1067831967 10:49615542-49615564 GTGGTGTTGGGTGGGGAGAGGGG + Intronic
1067924782 10:50497159-50497181 GTGGGGAAGAGAGGTGTGGGTGG - Intronic
1068886055 10:62098187-62098209 GGGGTGATGGAAGGTGAGAGTGG + Intergenic
1069415695 10:68198860-68198882 GGGGGGATGGGAGGGGTGAGGGG + Intronic
1069562428 10:69440055-69440077 GTGGAGATAAGAGGTGTGAATGG + Intergenic
1069572648 10:69503776-69503798 GTGGTGATGGGAAGTGCCCGCGG + Intronic
1069631951 10:69902613-69902635 GTGGTGATGGGGGGAGGAAGCGG - Intronic
1069634727 10:69918157-69918179 GCGGGGTTGGGAGGAGTGAGCGG + Intronic
1069920241 10:71811879-71811901 GTGGTGTTGGGGGGTGAGGGAGG - Intronic
1072553165 10:96494315-96494337 TTGGTGATAGGAGGTGGCAGCGG - Intronic
1072916308 10:99539255-99539277 GTGGTGCTGGGAGCACTGAGAGG - Intergenic
1073444067 10:103570591-103570613 GTGGGGAGAGGAGGTGGGAGAGG + Intronic
1073982356 10:109169064-109169086 GTGGTGGTGGGGGGTGGGGGTGG - Intergenic
1074326320 10:112455208-112455230 GAGGTGAGGGGAGGGGGGAGGGG - Intronic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1075674406 10:124286396-124286418 GTGGGCATGGGAGGGATGAGGGG + Intergenic
1075776889 10:124994993-124995015 GTGGTGATGGGAGGGGCATGTGG - Intronic
1075818898 10:125288354-125288376 GTGGGGAAGGGAGGTATAAGTGG + Intergenic
1076444278 10:130501239-130501261 GGGGTCATGGGTGGTGGGAGGGG + Intergenic
1076482036 10:130791260-130791282 GGGGGGATGTGTGGTGTGAGTGG - Intergenic
1076618420 10:131771672-131771694 GTGGTGATGGGTGCAGTGACAGG + Intergenic
1076687515 10:132204704-132204726 CTGGTGGTGGCAGGTGTGCGGGG + Intronic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1077425335 11:2473416-2473438 CTGGTGTTTGGAGATGTGAGGGG + Intronic
1079186124 11:18238798-18238820 GTGGGGAGGGGGGGAGTGAGGGG - Intergenic
1080041066 11:27759885-27759907 GTGGGGTTGGGAGATGTGATTGG + Intergenic
1080533358 11:33198157-33198179 GGGCTGGTGGGAGGAGTGAGCGG - Intergenic
1081651169 11:44825085-44825107 GTGGTGGGGGGTGGTGGGAGGGG - Intronic
1081729463 11:45359545-45359567 GAGGTGATGGGAGGTGGGATGGG + Intergenic
1081774996 11:45670738-45670760 GAGGTGATGGGAGTTGGGGGCGG + Intergenic
1081967625 11:47179118-47179140 GTGGGGATGGGAGGTGGGATGGG - Intronic
1082781747 11:57293569-57293591 GTGGTGGTGGTTGGTGTCAGGGG - Intergenic
1083200228 11:61116759-61116781 GTGGTGGTGCGTGGTGTGTGTGG - Intronic
1083290755 11:61688753-61688775 GGGGTGAGGGGAGGTCTGGGTGG - Intronic
1083292255 11:61696608-61696630 GTGGGGTGGGGAGCTGTGAGAGG + Intronic
1083380440 11:62263927-62263949 GTGGTCTTGGGAGGTGTCCGTGG - Intergenic
1083399413 11:62413624-62413646 GTGGCAATGGCAGGTGGGAGGGG - Intronic
1083587225 11:63869206-63869228 GTGGGGGTGGGTGGGGTGAGGGG - Intronic
1084275262 11:68048000-68048022 GTGGTGAAGGCAGCTGGGAGTGG + Intronic
1084373440 11:68760166-68760188 GTGGTGATGGGATGGGTAATGGG - Intronic
1084770108 11:71337105-71337127 CTGGTGACAGGAGGTGTGCGTGG - Intergenic
1084944793 11:72632773-72632795 GGGGTGGTGGGAGGTGTGAGGGG - Intronic
1084950297 11:72661441-72661463 GTGGTGACTGTGGGTGTGAGTGG - Intronic
1085344002 11:75754485-75754507 GTGGTGGGGGGAGGGGGGAGGGG + Intergenic
1085447978 11:76614179-76614201 GTGGTGATGGATGGGATGAGAGG + Intergenic
1085689246 11:78652088-78652110 GTGGGGGAGGGAGGTGTGACGGG + Intergenic
1086337646 11:85814668-85814690 GTGGTGTTGGGTGGTGTTAGGGG - Intergenic
1086554831 11:88096888-88096910 GTGGTCATGGAAGGGGCGAGGGG + Intergenic
1086678739 11:89641814-89641836 GTGGTCCTTGGAGGAGTGAGAGG - Intergenic
1086846121 11:91751715-91751737 GTGGTGGTGGGAGTTGTGGTGGG + Intergenic
1087096859 11:94327399-94327421 GTGGTGGTGGGGGGTGGGACGGG + Intergenic
1087702910 11:101456644-101456666 GGGGTGGTGGGAGCTGTGACTGG - Intronic
1088766287 11:112982565-112982587 GAGGTGATGGGAGGTGGAATTGG + Intronic
1088833131 11:113555058-113555080 GTGGTGTGGGGAGGTGTAGGGGG - Intergenic
1088905550 11:114152968-114152990 GTGGTGATGGTAGTGGTGGGAGG + Intronic
1089173126 11:116529240-116529262 GTGGAGATGGGGTGGGTGAGTGG - Intergenic
1089182181 11:116590628-116590650 GAGGTCATGGGGGGGGTGAGGGG - Intergenic
1089620044 11:119717033-119717055 GGAGTGATGGGAGATGAGAGAGG + Intronic
1089769573 11:120793603-120793625 GAGGTGAAGGGTGGTGTTAGGGG + Intronic
1091095959 11:132822258-132822280 GCGGTGGGGGGAGGTGGGAGAGG - Intronic
1091108658 11:132944670-132944692 GTGGTGCTGGGAGGTGACTGGGG + Intronic
1091169757 11:133509581-133509603 GTTGTCATAGGAAGTGTGAGAGG - Intronic
1091251161 11:134145455-134145477 GTGGTGGTGGGAGGTGGGGGAGG + Intronic
1091577862 12:1756073-1756095 GTGGTGGTGGGAGGCAGGAGGGG - Intronic
1091709961 12:2732715-2732737 GTGGGGATGGGTGGTGAGATGGG - Intergenic
1092228539 12:6764482-6764504 GCGGTGATTGGAGGGGGGAGAGG + Intronic
1092241079 12:6837031-6837053 GCGTTCATGGGGGGTGTGAGGGG - Exonic
1092285920 12:7129292-7129314 GTGATGTTGGAAGATGTGAGGGG + Intergenic
1092342097 12:7685549-7685571 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1093213646 12:16337111-16337133 GAGAGGCTGGGAGGTGTGAGTGG + Intergenic
1094318066 12:29153792-29153814 TTGGATATGGGAGGTGGGAGAGG + Intronic
1096218428 12:49811410-49811432 GTGGCGGCAGGAGGTGTGAGGGG - Intronic
1096241587 12:49962692-49962714 GAGGTGATGGGAGAGGTGAGGGG - Intronic
1096574292 12:52543182-52543204 GTGGGGAGGGGAGGTGTAGGAGG - Intergenic
1096584132 12:52608514-52608536 GTGGGGCTGGGAGGTTGGAGGGG - Intronic
1096792490 12:54053700-54053722 GTGGTGCTGGGAGGCGGGGGTGG - Intronic
1096876620 12:54634709-54634731 GGGGTGAAGGCAGGAGTGAGGGG + Intronic
1097266268 12:57746848-57746870 GTGTTGGTGGGAGGTGGGGGTGG + Intronic
1097276041 12:57814259-57814281 ATGGGGAAGGGAGGTGGGAGGGG - Intronic
1097323102 12:58246850-58246872 GTGGTGGTGGGGGGTGGGAGGGG + Intergenic
1098005987 12:65997559-65997581 GTGGTGATGGGATATGTGGTGGG - Intergenic
1099860230 12:88217394-88217416 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1100430688 12:94529425-94529447 GGGGTGAGGAGAGGTGTCAGAGG + Intergenic
1101400873 12:104385597-104385619 GTGGTGATGGGAGTGGTGATGGG - Intergenic
1103602528 12:122063399-122063421 TTGATGAAGGGAGGTGGGAGAGG - Intergenic
1103698398 12:122835186-122835208 GTGGGGGTTGGAGGTGTGCGGGG + Intronic
1104033095 12:125079227-125079249 GGAGTGTGGGGAGGTGTGAGAGG + Intronic
1105332983 13:19435428-19435450 GTGGGGTTGAGGGGTGTGAGTGG + Intronic
1105878716 13:24584366-24584388 GTGGGGTTGAGGGGTGTGAGTGG - Intergenic
1105921128 13:24964696-24964718 GTGGGGTTGAGGGGTGTGAGTGG + Intergenic
1106110271 13:26771036-26771058 GTGGGGGTGGGGGGTGTGGGGGG + Intergenic
1106543804 13:30713599-30713621 GAGATGAGAGGAGGTGTGAGGGG - Intronic
1107823273 13:44305311-44305333 GTTGAGATTGGAGGTGCGAGTGG - Intergenic
1108478799 13:50846025-50846047 GTGGGGATGTGATGTGTGATGGG - Intergenic
1108535481 13:51372192-51372214 GGGGTTATGGGAGGAGTGAGAGG - Intronic
1109254411 13:60061610-60061632 GTGGGGGTGGGAGGTGTGTGTGG - Intronic
1110158108 13:72342643-72342665 GTGGTGCGGGGAGGTGGGAAGGG - Intergenic
1110195068 13:72779763-72779785 GTGGTGGTGGGGGGGGTAAGGGG + Intronic
1111532799 13:89561490-89561512 GTGGAGGTGGGAGGAGGGAGAGG + Intergenic
1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG + Intergenic
1112033315 13:95476058-95476080 GTGGTGATAGGACATATGAGGGG + Intronic
1112096977 13:96144787-96144809 GTGGTGGGGGGAGGGGGGAGGGG - Intronic
1112605692 13:100903871-100903893 GTGGTGGTAGAAGGTGGGAGAGG + Intergenic
1113302336 13:109035753-109035775 GTGGTGCTGGCAGGTGAGAAAGG - Intronic
1113573126 13:111372896-111372918 GTCGTGGTGGGAGGTGAAAGGGG - Intergenic
1114547735 14:23514595-23514617 GTGGTGATGAGAGATGAAAGCGG - Intergenic
1114567156 14:23641125-23641147 GAGGTGATGGCAGATGTGATCGG - Intronic
1115443585 14:33463888-33463910 GTGGGGATGGGAGGTTTTTGTGG + Intronic
1115499538 14:34037089-34037111 GTGGTGGTGGGAGTGGGGAGTGG - Intronic
1115510027 14:34129794-34129816 GTGGGGAAGGGAGGTGGCAGAGG + Intronic
1115682873 14:35761312-35761334 GTGGTGATGGGAGGTAGGCAAGG - Intronic
1117301372 14:54431727-54431749 GTGGTCTTGGGAGGTGTGGAGGG + Intronic
1117709531 14:58510948-58510970 GGGGTGATGGTAGGAGTTAGAGG + Intronic
1117956896 14:61130122-61130144 GTGGTGATGAGAGATGTCATGGG + Intergenic
1117968164 14:61226859-61226881 GTGGTAATGGGAAGTGGAAGGGG - Intronic
1118508703 14:66445818-66445840 GTGGGGATGGGGGGTGGGGGAGG - Intergenic
1119136854 14:72229254-72229276 GGGGTGAGGGGAGGGGTGGGAGG - Intronic
1119726462 14:76924611-76924633 GGGGTGATGGGGGATGTGATAGG - Intergenic
1119771202 14:77221415-77221437 GTGGGGAGGGGAGGCGTGAGTGG - Intronic
1119771272 14:77221639-77221661 GGTGGGAGGGGAGGTGTGAGAGG - Intronic
1119995814 14:79252576-79252598 GTGGTGGTGGGAGGTGGGTAGGG + Intronic
1120775900 14:88437723-88437745 GTGGTGGTGGGAGAAGTGAAAGG + Intronic
1121045381 14:90784092-90784114 GTCCTGCTGGGAGGTGTGAGGGG - Intronic
1122791432 14:104185639-104185661 GGGGTGAGGGTAGGTGTGGGGGG + Intergenic
1122915147 14:104855069-104855091 GGGGTGAATGGAGGTGGGAGTGG + Intergenic
1123055595 14:105567851-105567873 GTGGTGTGGGCAGGTGTGTGGGG + Intergenic
1123625223 15:22222720-22222742 GTGGTTTTGGGAGGTGAGGGAGG - Intergenic
1125294798 15:38191074-38191096 GTGCTGTGGTGAGGTGTGAGGGG + Intergenic
1125846501 15:42859595-42859617 GTGGTAATGGGTGGAGAGAGGGG - Intronic
1126389005 15:48125904-48125926 GTGGTGATTTGAGGAGTGAGTGG - Intronic
1126854254 15:52822676-52822698 GTGGTGATTGGTGGGGTGTGGGG + Intergenic
1126908220 15:53389945-53389967 GTGGGGGTGGGAGTTGTGGGGGG + Intergenic
1127184519 15:56464567-56464589 GTGGTGGTGGGTGGAATGAGGGG - Intronic
1127766528 15:62190484-62190506 ATGGTGATGAGAGATGGGAGTGG - Intergenic
1127790496 15:62394216-62394238 GTGGTGTTGTGATGTGTGTGTGG + Intronic
1127881199 15:63159766-63159788 GTGGTAATGGAAGGTCTGAGAGG + Intergenic
1128787654 15:70410190-70410212 AAGGTGATGAGAGTTGTGAGAGG + Intergenic
1129480993 15:75826138-75826160 GTTGTTATGGGAGGTGGGACAGG + Intergenic
1129745171 15:78013965-78013987 GGAGAGACGGGAGGTGTGAGAGG + Intronic
1130045995 15:80445314-80445336 GTGGGGGTGTGTGGTGTGAGTGG + Intronic
1130081232 15:80735479-80735501 GTGGAGGTGGGTGGTGAGAGTGG - Intronic
1131032066 15:89194860-89194882 CTGGGGGTGGGAGGTGGGAGAGG - Intronic
1131467763 15:92669212-92669234 GGGGTGCTGGGAGGTGGGGGTGG - Intronic
1131535381 15:93232859-93232881 GGGGTGGTGGGGGGTGTGGGGGG + Intergenic
1131593558 15:93773941-93773963 GATGTGGTGGGAGGTGGGAGAGG - Intergenic
1131605163 15:93895838-93895860 GTGGTGATGGTGGTGGTGAGAGG + Intergenic
1131701638 15:94943006-94943028 GGGGTGGGGGGAGGTGAGAGGGG + Intergenic
1131964574 15:97828039-97828061 GTGGTGGTGGGAGGAGAAAGAGG - Intergenic
1132343114 15:101090412-101090434 TTGTTGATGGGAGGGGTGACAGG - Intergenic
1132597465 16:759959-759981 GTGCTGAACGGAGGTGTGCGCGG - Intronic
1132772936 16:1574696-1574718 TTGGTGGTGGGAGGTGGGAAGGG - Intronic
1132875402 16:2134950-2134972 CTGGCCACGGGAGGTGTGAGGGG - Intronic
1133319493 16:4904093-4904115 GTGGCAATGGGAGGGGTGGGAGG + Intronic
1133426475 16:5694717-5694739 GTGGGGTTGGGGGCTGTGAGTGG - Intergenic
1133813798 16:9181198-9181220 GTGGTGGTGGGGAGTGTGAGAGG + Intergenic
1134431277 16:14209212-14209234 GTGGTGATGGCTGGAATGAGAGG - Intronic
1134519582 16:14912410-14912432 CTGGCCACGGGAGGTGTGAGGGG + Intronic
1134554349 16:15153825-15153847 CTGGCCACGGGAGGTGTGAGGGG - Intergenic
1134707254 16:16311066-16311088 CTGGCCACGGGAGGTGTGAGGGG + Intergenic
1134960287 16:18401059-18401081 CTGGCCACGGGAGGTGTGAGGGG - Intergenic
1135249834 16:20891616-20891638 GTGGTGATGGGTGGTGGGTGTGG + Intronic
1135972013 16:27079157-27079179 GTGGGGAGTGGAGGTGTGATTGG - Intergenic
1136986283 16:35108630-35108652 GGGGTGAGGGGAGGGGGGAGGGG - Intergenic
1137577171 16:49607947-49607969 GTTGTCATGGGAGTTGGGAGGGG - Intronic
1137613327 16:49833586-49833608 GAGGGGGTGGGAGGTGGGAGGGG - Intronic
1137714928 16:50592767-50592789 GTGGTGATGGGGAGGGGGAGGGG + Intronic
1138262810 16:55637376-55637398 GTGGTGATGGGGGTGGGGAGAGG + Intergenic
1138276310 16:55737380-55737402 GAGGTAATGGGAAGTGGGAGAGG + Intergenic
1138291894 16:55855022-55855044 CTGGTGATGGAAGGGGTGGGTGG - Intronic
1138567159 16:57841883-57841905 GTGGGGATGGGGTGTGTGGGGGG - Intronic
1138600337 16:58050137-58050159 TTGGGGGTGGGAGGTGTCAGAGG - Intergenic
1138703648 16:58892358-58892380 GAGATGATGGTAGTTGTGAGTGG - Intergenic
1138703662 16:58892444-58892466 ATGGTGATGGCAGTGGTGAGTGG - Intergenic
1138703680 16:58892530-58892552 ATGGTGATGGCAGTGGTGAGTGG - Intergenic
1138703709 16:58892653-58892675 ATGGTGATGGGAGTGATGAGTGG - Intergenic
1138703716 16:58892705-58892727 GTGGTGGTGGTAGCTGTGTGGGG - Intergenic
1138703732 16:58892800-58892822 GTGGTGGTGGCAGCTGTGTGGGG - Intergenic
1139087281 16:63602565-63602587 GTGGGGATGGGGGGTGAGAATGG + Intergenic
1139312606 16:66040184-66040206 GTGGGGTGGGGAGGTGTGAAGGG - Intergenic
1139554335 16:67697057-67697079 GTGGTGATGGGAAATGTATGTGG - Intronic
1139612200 16:68067195-68067217 GAGGAGATGGGAGGGGAGAGGGG - Intronic
1139612209 16:68067217-68067239 GAGGAGATGGGAGGGGAGAGGGG - Intronic
1139673698 16:68508939-68508961 GTGGGGACGGGGGGTGTGAAGGG - Intergenic
1139689316 16:68629772-68629794 AAGGTGTTGGGAGGTGGGAGTGG + Intergenic
1140044238 16:71430157-71430179 GAGGAGATGGCAGGTGTTAGAGG + Intergenic
1140918349 16:79513982-79514004 GTGGTGAGGGGAAGGGTGGGGGG - Intergenic
1141026348 16:80552284-80552306 GTGGTGATGGGAGAGGAGACAGG + Intergenic
1141735767 16:85851564-85851586 GTGGTGATGGGGTGTGTGCAAGG - Intergenic
1142170855 16:88622026-88622048 GGGGTGATGGGTTTTGTGAGTGG + Intronic
1142183956 16:88685749-88685771 GGGGTGAAGGGAGGTGGGGGAGG + Intronic
1142273088 16:89101186-89101208 GTGTAGATGGCTGGTGTGAGCGG - Exonic
1142499033 17:322104-322126 GTGGTGAGGGCAGGTGAGGGCGG + Intronic
1142697978 17:1643976-1643998 GTGGGGACGGGAGGGGTCAGCGG + Intronic
1143445401 17:7006218-7006240 GAGGTGAGGGGAGCTGTGGGGGG + Intronic
1144722325 17:17480032-17480054 GAGGGGATGGGAGGTGGGACAGG - Intronic
1144767299 17:17739766-17739788 GTGGTGCGGGGTGGTGAGAGTGG + Intronic
1144776582 17:17787902-17787924 ATGGTGTTGGGGGCTGTGAGGGG + Intronic
1145057788 17:19714635-19714657 ATGGAGATGGCAGGTGGGAGGGG - Intronic
1146667719 17:34716004-34716026 GTGGTGGTGGGATGTGGGGGAGG - Intergenic
1146683460 17:34824819-34824841 GGGATCATGGGAGGTGGGAGTGG - Intergenic
1146810371 17:35898429-35898451 GTGGTAAAGGGTGGGGTGAGGGG - Intergenic
1147862755 17:43533216-43533238 GTGGGGCTGGGAGGTGCCAGAGG + Exonic
1147912053 17:43861734-43861756 GAAGGGGTGGGAGGTGTGAGGGG - Intronic
1147998707 17:44375517-44375539 GAGGGGATGGGAGGAGGGAGAGG - Intronic
1148393428 17:47289982-47290004 GAGGTGGTGAGGGGTGTGAGAGG + Intronic
1150604622 17:66680332-66680354 GTGGAGGTGGGAGGTGTCACGGG + Intronic
1150834207 17:68550078-68550100 GTGGTGATGGGGGAGGGGAGTGG + Intronic
1150947716 17:69765692-69765714 GTGGGGAGGGGAGGGGAGAGAGG - Intergenic
1151035019 17:70788884-70788906 GTGGTGATTGGAGGTGATAGTGG + Intergenic
1151481797 17:74373907-74373929 GTGGTGCTGAGAGGAGAGAGGGG - Intergenic
1151702320 17:75750061-75750083 GTGGTGAAGGGGGATCTGAGTGG + Intronic
1151805985 17:76405717-76405739 GTGCTGGTCGGAGGTGTGTGCGG - Intronic
1152232299 17:79120070-79120092 CTGGGGTTGGGTGGTGTGAGCGG + Intronic
1152686894 17:81698456-81698478 GTGGCCATGGGAGGCGTCAGTGG + Intronic
1152695673 17:81792958-81792980 GTGGGGGTGGGTGGTGTGTGTGG - Intergenic
1153076612 18:1168839-1168861 GTGGTCATGGTAGGTCTCAGTGG + Intergenic
1153092931 18:1369163-1369185 CAGGTGATGGAAGGTCTGAGAGG - Intergenic
1154193843 18:12252065-12252087 GTGGTGGGGAGAGGTGGGAGAGG - Intergenic
1154290945 18:13106285-13106307 GTGGTGGTGGTAGTTGTGTGGGG - Intronic
1154290964 18:13106402-13106424 ATGGTGATGGCAGTGGTGAGTGG - Intronic
1154291002 18:13106574-13106596 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1154291031 18:13106737-13106759 GTGGTGGTGGTAGCTGTGTGGGG - Intronic
1155153543 18:23140378-23140400 GTGCTGATGGGAGGGGTGCATGG + Intronic
1155188191 18:23405680-23405702 GTAGTCATGGGAGGAGAGAGAGG + Intronic
1155507347 18:26547028-26547050 GTGGTGGTGGGAGGGATGGGTGG + Intronic
1156185293 18:34655358-34655380 GTGGAGGTGGGAGGTGGGGGAGG - Intronic
1156325064 18:36067485-36067507 GTGGGGAAGGGTGGGGTGAGGGG - Exonic
1156700509 18:39819095-39819117 GAGGAGATGGGAGGGGTGAGGGG + Intergenic
1156911305 18:42413953-42413975 GAGGGTATGGGAGGGGTGAGTGG + Intergenic
1157680252 18:49599994-49600016 TCAGTGATGTGAGGTGTGAGAGG - Intergenic
1157701034 18:49761699-49761721 GTGGGGATGTGGGGTGTGTGGGG - Intergenic
1157883249 18:51341988-51342010 GTGGTGGTGGCAGGAGTGGGTGG + Intergenic
1157968041 18:52231154-52231176 GTGGCCATGGGAGGAGGGAGGGG + Intergenic
1158229991 18:55243731-55243753 GTTGTGAGGGTACGTGTGAGGGG + Intronic
1158391162 18:57046390-57046412 CTGGTGAGGGGAGGTGGGAAGGG + Intergenic
1158696128 18:59705667-59705689 GTGTTGTTGGGATGTGTGAGGGG - Intergenic
1158718210 18:59899653-59899675 GTGGTGGCGGGAGCTGGGAGTGG - Intergenic
1159333547 18:67032923-67032945 GTGGTGATGGAGGATATGAGAGG - Intergenic
1159346446 18:67212858-67212880 GTGAAGATGGGAGGAGGGAGTGG - Intergenic
1159766985 18:72502828-72502850 GTGGGGCTGGGAGATGGGAGAGG + Intergenic
1159919194 18:74212513-74212535 GTGGCGATGGGAGCTATGTGTGG - Intergenic
1159950349 18:74478331-74478353 GTGGTGGGGGGAGGAGTGGGTGG - Intergenic
1160082868 18:75746080-75746102 GTGGTGAAGGGAGCTCTGAATGG - Intergenic
1160089255 18:75810763-75810785 GTGCTGATTGGGGGTGGGAGAGG - Intergenic
1160322093 18:77905672-77905694 CTGGCCATGGGTGGTGTGAGGGG - Intergenic
1160566029 18:79787263-79787285 TAGGTGCTGAGAGGTGTGAGGGG + Intergenic
1160657522 19:281253-281275 GGGCTGATGGGAGCAGTGAGCGG - Exonic
1160689272 19:453691-453713 GAGGTGCGGGGAGTTGTGAGAGG - Intronic
1161065445 19:2235378-2235400 GTGGGGGTAGGAGGAGTGAGAGG - Intronic
1161085426 19:2332921-2332943 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161085447 19:2332982-2333004 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161085468 19:2333043-2333065 GTGGGGATGGCAGGTGTGGGCGG + Intronic
1161085506 19:2333164-2333186 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161085558 19:2333337-2333359 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161088028 19:2344105-2344127 GGGGTGATGGGGGGGGTGATGGG - Intronic
1161608607 19:5228833-5228855 CGGGTGATGAGAGGTGTCAGCGG - Intronic
1161609220 19:5231644-5231666 GTGGGGAAGGGAGGTGGGATGGG + Intronic
1161724059 19:5918389-5918411 GTGGGGAGGGGAGGGGGGAGGGG - Intronic
1161868951 19:6855750-6855772 ATGGTGATTGGAAGGGTGAGTGG - Intronic
1161872386 19:6880159-6880181 CAGGGGATGGGAGGTGGGAGGGG + Intergenic
1162260215 19:9527037-9527059 GTAATGATGGAAGGTCTGAGAGG + Intergenic
1162583784 19:11546781-11546803 GTGGGGAGGGGAGGTCTGAGGGG - Intronic
1163162200 19:15471434-15471456 GTAGAGATGGGTGGTGTGGGGGG + Intronic
1163444730 19:17339613-17339635 GTGGTGATGGGAGGGGAACGCGG + Intronic
1163664603 19:18597409-18597431 GAGTGGAAGGGAGGTGTGAGTGG - Intronic
1163711735 19:18851130-18851152 GTGAGGATGGGTGGTGGGAGGGG + Intronic
1163862156 19:19748160-19748182 GTGGGGACAGCAGGTGTGAGAGG - Intergenic
1164822836 19:31263694-31263716 GTGGGGATGTGAGGAGTGGGGGG - Intergenic
1164825008 19:31278486-31278508 GTTGTGATGGTAGGTGTGACAGG + Exonic
1165570867 19:36773497-36773519 CTTGTGATCGCAGGTGTGAGTGG + Intronic
1165745253 19:38226765-38226787 GAGCTAATGGGAGGTGAGAGAGG - Intronic
1166198085 19:41219544-41219566 GGGATGATGGCAGGTGTGGGGGG + Intronic
1166297630 19:41896794-41896816 GAGGAGAGGGGAGGTGAGAGAGG - Intronic
1166471000 19:43079543-43079565 GTGCTGATGCAGGGTGTGAGTGG + Intronic
1166661727 19:44651613-44651635 GTGGTGATGTGGGGTGAGACTGG - Intronic
1166712067 19:44944143-44944165 GTGGTGAAGGGAGGCATCAGAGG + Intronic
1166888115 19:45973581-45973603 GAGGGGAGGGGAGGTGGGAGGGG + Intergenic
1166895174 19:46018253-46018275 GTGGGTATGGGGGCTGTGAGGGG - Intronic
1167417936 19:49386830-49386852 GAGGGGAAGGGAGGTGGGAGGGG + Intergenic
1167436500 19:49481494-49481516 GGAGCCATGGGAGGTGTGAGAGG + Intronic
1168115822 19:54220995-54221017 GTGGTGATGGCCGGGATGAGGGG - Intronic
1168118802 19:54240743-54240765 GTGGTGATGGCCGGGATGAGGGG - Intronic
1168133748 19:54337310-54337332 GTGGTGATGGCCGGGATGAGGGG - Intronic
1168172129 19:54596001-54596023 GTGGTGATGGCCGGAATGAGGGG + Intronic
1168182573 19:54672153-54672175 GTGGTGATGGTTGGGATGAGGGG + Intronic
1168185666 19:54698011-54698033 GTGGTGATGGCCGGGATGAGGGG + Intronic
1168187638 19:54709917-54709939 GTGGTGATGGCCGGGATGAGGGG + Intergenic
1168490416 19:56804113-56804135 GTGGGGATAGCAGGGGTGAGAGG + Intronic
1168494854 19:56839993-56840015 GTGGTGGTGGGAGGGGCGAAGGG - Intronic
1168564981 19:57415154-57415176 GTGGAGGTGGGAGGGGTGGGTGG + Intronic
1168602027 19:57726102-57726124 GTGGGGTGGGGAGGTGGGAGGGG - Intronic
925302199 2:2825472-2825494 TTGGCCAAGGGAGGTGTGAGGGG - Intergenic
925666643 2:6264027-6264049 GTTGTGATGGGATGGTTGAGAGG + Intergenic
926218950 2:10922582-10922604 ATGGTGCTGGGAGATGGGAGGGG + Intergenic
926364032 2:12116427-12116449 GTGGTGAAGTGAGGGGGGAGGGG - Intergenic
927145612 2:20163731-20163753 GTGGTGTGGGGAGGTGTAAATGG + Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927809966 2:26175342-26175364 GAGGTGTTGGGAGTTGGGAGGGG - Intronic
928389777 2:30900201-30900223 ATGGTGATGGAAGGGTTGAGGGG - Intergenic
928589859 2:32803116-32803138 GTGATGGTGGGAGGTGGCAGTGG - Intronic
928914183 2:36454346-36454368 GTGGTGGTGAGGGGTGTGAGTGG - Intronic
929084321 2:38153409-38153431 CAAGTGATGGGAGGTGGGAGTGG + Intergenic
929455438 2:42061655-42061677 GGGGAGGTGGCAGGTGTGAGTGG - Intergenic
931822183 2:65963205-65963227 GCGGTGAGGGGAGGGGGGAGGGG - Intergenic
932736181 2:74256312-74256334 GTGGAGAGGGGAGGTCTGGGTGG - Intronic
933353741 2:81189888-81189910 GTGGTGATGAGATGTTTGGGAGG - Intergenic
933663483 2:84946130-84946152 GGGGAGAGGGGAGGTGAGAGGGG + Intergenic
933918070 2:87016821-87016843 ATGGAGATGGGAGGGGTCAGGGG - Intronic
934004924 2:87753093-87753115 ATGGAGATGGGAGGGGTCAGGGG + Intronic
934857844 2:97739883-97739905 GGGGTGAGGGTAGGTGTCAGGGG + Intergenic
935426080 2:102919569-102919591 GTTGTGGGGGTAGGTGTGAGGGG + Intergenic
935459974 2:103318784-103318806 TTGGAGATGGGAGCTTTGAGAGG + Intergenic
935470738 2:103456535-103456557 GTGGGGATGGGAGGAATGAATGG + Intergenic
935767883 2:106387124-106387146 ATGGAGATGGGAGGGGTCAGGGG + Intergenic
935980961 2:108626522-108626544 ATGGGGGTGGGAGGTGAGAGTGG - Intronic
936521534 2:113214860-113214882 ATGGTGAGGGCAGGTGGGAGAGG + Intergenic
937090461 2:119202817-119202839 GAGGTGATGGGAAGGGGGAGGGG - Intergenic
937466647 2:122138778-122138800 CTGGTGCTGGCAGGTGGGAGGGG - Intergenic
937864298 2:126736579-126736601 GTGGTGACGGGATGTGAGAAGGG - Intergenic
938026649 2:127955114-127955136 GTGGTGATGGGTGGAGTGATGGG + Exonic
941874701 2:170420852-170420874 GTGGTGATGAGGGGTGTCGGTGG - Intronic
942598747 2:177618685-177618707 GTGGTTATGGCTGGTCTGAGCGG - Exonic
942665066 2:178308813-178308835 GAGGTGATGAGAGCTGTGAGAGG - Intronic
942763604 2:179428436-179428458 TTGGTGATGGGAGGGGGCAGAGG + Intergenic
942843660 2:180396546-180396568 GTTGTGAGGGGAGGTGGGAATGG + Intergenic
944068701 2:195646614-195646636 GTGGTGGGGGGAGGTGGGTGGGG - Intronic
944168028 2:196743554-196743576 GTGGGGGTGGGGGGTGGGAGGGG - Intronic
944523411 2:200594374-200594396 GTGTTGAAGGGAGGTCTGTGAGG + Intronic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946073694 2:217055850-217055872 TTGGTGATGGGAGGTGTAGAGGG + Intergenic
946402069 2:219473418-219473440 GTGTTGATGAGGGGTGTTAGAGG + Intronic
947398636 2:229711839-229711861 GTGGGGAGGGGAGGGGAGAGAGG - Intronic
947531632 2:230912293-230912315 GAAGTCATGGGAGGTGGGAGAGG - Intronic
947698750 2:232215312-232215334 GTGGGGATGGGAAATGTGAGCGG - Intronic
948284744 2:236774690-236774712 TTGGTGATGGGGGTGGTGAGGGG + Intergenic
948605011 2:239129436-239129458 GTGGTGCTGGGCGGGGTGTGGGG + Intronic
948685630 2:239668056-239668078 GTGATGAACGGAGGTGGGAGGGG - Intergenic
948716268 2:239865493-239865515 GTGGTGAGGGGCGGAGTGCGCGG - Intergenic
948797714 2:240413182-240413204 GTGGAAATGGGAGGGCTGAGAGG + Intergenic
948860752 2:240751603-240751625 GTGGTGATGGGACAGTTGAGGGG - Intronic
948957110 2:241302066-241302088 GTAGAGATGGGAGTTGTGGGGGG - Intronic
1168823521 20:793291-793313 GTGGTGATCTGAGGTGGCAGTGG - Intergenic
1168870740 20:1126045-1126067 ATGGTGAAGGGCTGTGTGAGTGG - Intronic
1169305391 20:4485235-4485257 TGGGTGGTGGGAGGTGGGAGTGG + Intergenic
1169328429 20:4696826-4696848 GTGGAGATGGGTGGTGAGAGAGG - Intronic
1169725430 20:8724064-8724086 GTGGAGGTGGGAGGAGGGAGAGG + Intronic
1169831820 20:9833593-9833615 GTGGTGGTGGGGGAGGTGAGTGG - Intronic
1170122261 20:12924111-12924133 ATGGTGGTGGGAGGGGTGGGGGG + Intergenic
1170194838 20:13679408-13679430 CTGGTGGTGGGAGGTGGGGGTGG + Intergenic
1171254486 20:23679111-23679133 GTGGTGAAGGGAGAAATGAGTGG + Intergenic
1171389191 20:24790249-24790271 GGAGTGAGGGGAGGAGTGAGGGG + Intergenic
1171411154 20:24949699-24949721 GAGGTGCTGGGAGTGGTGAGAGG + Intronic
1173172941 20:40742056-40742078 GTGGTGGTGGGTGGTGGGCGGGG + Intergenic
1173946880 20:46958679-46958701 GTGGTGGTGGGAGGTGGGAGAGG - Intronic
1173959266 20:47058481-47058503 CTGGTGATGGCAGGAGAGAGAGG + Intronic
1174331600 20:49824039-49824061 GGGGTGATGGGAGGAGGGGGAGG - Intronic
1174353282 20:49982918-49982940 GGGGTGGTGGGGGGTGGGAGGGG - Intergenic
1174353820 20:49985561-49985583 GTCCAGATGGGAGGTGAGAGAGG - Intronic
1174504203 20:51006051-51006073 ATGGTGATGGGGGGGGTGGGTGG + Intronic
1175801915 20:61805760-61805782 GGGGTGATGGCCGGTGTGAGAGG - Intronic
1175915593 20:62424294-62424316 GTGGGGGGGGCAGGTGTGAGGGG + Intronic
1176740044 21:10593138-10593160 GTGGGGTTGGGGGGTGTGAGTGG - Intronic
1177932983 21:27308197-27308219 GTGGTGATGGTAAGGGTGGGGGG + Intergenic
1178538828 21:33432414-33432436 GAGGTCATGGGTGGTGGGAGTGG + Intronic
1178815506 21:35925574-35925596 GTGGTGAGGGGTGGAATGAGAGG - Intronic
1179452181 21:41474540-41474562 GAGGTGAGGGGATGAGTGAGGGG + Intronic
1179452428 21:41475270-41475292 GGGGTGAAGGGATGAGTGAGGGG + Intronic
1179603604 21:42497163-42497185 GAGGAAATGGGAGATGTGAGGGG - Intronic
1179884298 21:44306880-44306902 GTGGTCTTGGGGAGTGTGAGGGG + Intronic
1180617403 22:17137459-17137481 GTGGGGAAAGGAGGAGTGAGTGG - Intergenic
1180790681 22:18573987-18574009 GTGGGGATGGGAGCTCTGTGTGG - Intergenic
1180869238 22:19137161-19137183 GTGCTGAAGGCAGGTGTGGGTGG - Intronic
1181025110 22:20123424-20123446 GTGGTGTTGGGGGGGGTGTGTGG + Intronic
1181231056 22:21421327-21421349 GTGGGGATGGGAGCTCTGTGTGG + Intronic
1181247592 22:21513541-21513563 GTGGGGATGGGAGCTCTGTGTGG - Intergenic
1181506474 22:23361741-23361763 CTGGTGATGGAAGGGGTGGGTGG - Intergenic
1181820933 22:25475149-25475171 TTGAGCATGGGAGGTGTGAGTGG + Intergenic
1181876785 22:25945990-25946012 GAGGGGAGGGGAGGTGGGAGGGG - Intronic
1181876797 22:25946012-25946034 GAGGGGAGGGGAGGTGGGAGGGG - Intronic
1181876806 22:25946029-25946051 GAGGGGAGGGGAGGTGGGAGGGG - Intronic
1182096846 22:27631168-27631190 GGGGTGGTGGGAGGTGGGTGGGG - Intergenic
1183062140 22:35342710-35342732 GTGGTGTGTGGAGGTGTGTGTGG - Intronic
1183062188 22:35343024-35343046 GTGGTGTGTGGAGGTGTGTGTGG - Intronic
1183062207 22:35343147-35343169 GTGGTGTGTGGAGGTGTGTGTGG - Intronic
1183388671 22:37530414-37530436 TTCGTGATGGAAGGGGTGAGGGG + Intergenic
1183786534 22:40032168-40032190 GTGGTGGTGTGGGGTGGGAGGGG - Exonic
1183803431 22:40187651-40187673 GTGGAGGTGTGAGGTGGGAGAGG + Intronic
1183933015 22:41246823-41246845 GTGGGGATGGGAGGTGCGAGAGG + Intronic
1184453827 22:44598086-44598108 GTGGAGATGGAATGTGGGAGGGG - Intergenic
1184584760 22:45440410-45440432 GTGGTGAGGGGTGGGGTGGGGGG + Intergenic
1184776619 22:46626591-46626613 GTGGGGCTTGGAGGTGTGTGTGG + Intronic
1185336792 22:50274620-50274642 GTGCTGAGGGGAGGTGGGGGGGG - Intergenic
1185351137 22:50339749-50339771 GTGGTGGTGTGTGGTGTGTGTGG + Intergenic
1185384897 22:50527090-50527112 GTGGGGACGGGAGGGGTGAAGGG + Intronic
1185409357 22:50674231-50674253 GTGGGGGCGGGAGGTGTGTGCGG - Intergenic
949367381 3:3297845-3297867 GAAGTGATGGGAGGTTAGAGAGG - Intergenic
949519501 3:4836979-4837001 GTGGTGATAGTGGGTGTGGGTGG - Intronic
950465272 3:13149620-13149642 GACGTGATGGGAGGTGAGACTGG + Intergenic
950467729 3:13165286-13165308 GTGGTGATGTGAGATGGGAATGG + Intergenic
950630403 3:14278426-14278448 GGGATGGTGGGAGCTGTGAGAGG - Intergenic
950726733 3:14921792-14921814 GTGGTTCTGGGCAGTGTGAGAGG + Intronic
950891762 3:16410404-16410426 GTGGTGATGGTATGGGTGTGGGG + Intronic
950996346 3:17501546-17501568 GTGGTGATGGGAGTCCTGAAGGG - Intronic
952297492 3:32074121-32074143 GAGGTGCAGGGAGGTGGGAGAGG - Intronic
952976944 3:38704729-38704751 GAGGTGAGAGGAGGTGTGTGAGG + Intronic
953605616 3:44411402-44411424 TGGCTGGTGGGAGGTGTGAGGGG - Intergenic
953821679 3:46212399-46212421 GTGGTTTTGGGAGATGTAAGAGG + Intronic
953848738 3:46449385-46449407 GTGGTGATTGCAGGCGTTAGGGG - Intronic
953963348 3:47283194-47283216 GTGGGGAGAAGAGGTGTGAGGGG + Intronic
953971487 3:47351974-47351996 GTGGTGGTGGGCAGTATGAGTGG - Intergenic
954269915 3:49499749-49499771 GTGGTGATGGGAGGGGCCAGTGG + Intronic
954370360 3:50166853-50166875 GTGGTGGAGGAAGGAGTGAGGGG + Intronic
954445286 3:50543012-50543034 GTGGAGCTGGGAGGTGGGTGCGG + Intergenic
954576484 3:51679076-51679098 GAGGTGAGACGAGGTGTGAGAGG + Intronic
954629824 3:52041755-52041777 GTGATGCTGGGACATGTGAGGGG + Intergenic
954763706 3:52896463-52896485 GTGCTGATGGGGGGTGGGGGGGG - Intronic
954937440 3:54339398-54339420 GTCGTGGTGGGAGGTGTTAGGGG - Intronic
955505745 3:59631615-59631637 GTGTTGATGGGGAGAGTGAGTGG - Intergenic
955969247 3:64420524-64420546 GTTGTGATGGGAAAAGTGAGGGG + Intronic
956083153 3:65581078-65581100 GTGGTGATGGGAGCTGGCACAGG - Intronic
956339293 3:68203951-68203973 GTGGTCATGGGGGGTGGGGGGGG - Intronic
956379428 3:68650174-68650196 GTGGTGGGGGGAGGGGGGAGGGG - Intergenic
956797187 3:72727834-72727856 GTGTTGGTTGCAGGTGTGAGCGG - Intergenic
957198788 3:77105406-77105428 GTGGTGATGGTGGGTGGTAGGGG + Intronic
957463244 3:80550698-80550720 GCTGTGATGGGAGTAGTGAGTGG + Intergenic
957763233 3:84587262-84587284 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
959321725 3:104885329-104885351 GTGGTGGTGGGAGGTCAGAGTGG + Intergenic
959564528 3:107820776-107820798 TTGGTGGGGGGAGGTGGGAGAGG + Intergenic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
961141781 3:124562276-124562298 GTGGGGATGGGAGGTGTTGCAGG + Intronic
961660388 3:128465615-128465637 ATGGTCATGGTGGGTGTGAGGGG + Exonic
962868894 3:139470981-139471003 GTGGTCAGGGAAGGTTTGAGGGG - Intronic
962923232 3:139969709-139969731 GTGGTGGTGGGAGGTGTTATAGG - Intronic
963515889 3:146307312-146307334 GTGGTGGCGGGAGGGGTGCGGGG - Intergenic
965171120 3:165265690-165265712 GGGGTGAAGGGAGGGGGGAGGGG - Intergenic
965415315 3:168385219-168385241 CTGCTGCTGGGAGGTGGGAGAGG + Intergenic
965652267 3:170946915-170946937 GGGGAGAGGGGAGGTGAGAGGGG + Intergenic
966336059 3:178869578-178869600 GTGGTTAGTGGAGGTGTGAGAGG - Intergenic
967039384 3:185676026-185676048 GTGATGATGGGATTTGGGAGAGG + Intronic
967089746 3:186125451-186125473 GTGGTGTGGGGGGGTGTGTGTGG + Intronic
967089818 3:186125947-186125969 GTGGTGATGGTATGTTTGTGTGG + Intronic
967089851 3:186126174-186126196 GTGGTGATGGTATGTTTGTGTGG + Intronic
967117507 3:186355224-186355246 GCGGTGATGGTAGTTGTGTGGGG - Intronic
967256489 3:187597985-187598007 GTGGTAATGGGCGTTGTGGGTGG - Intergenic
967886646 3:194337899-194337921 GTGGTGTTGGGAGATGTGAGAGG + Intergenic
967889134 3:194352505-194352527 GTGGGTGTGGGGGGTGTGAGTGG + Intergenic
968033850 3:195528146-195528168 TTGGGGATGGGAGGGGTGAGAGG - Intronic
968090086 3:195894009-195894031 GTGGAGATGGCAGGTGTGGATGG + Intronic
968606621 4:1538426-1538448 GAGGTGAGGGGAGGAGTGGGAGG + Intergenic
968640235 4:1711165-1711187 TTGGGGATGGGAGGCGTGAAAGG - Intronic
968734198 4:2286777-2286799 GGGGTGACGGGAGGGGTGAGGGG + Intronic
969248574 4:5952585-5952607 GTGGTGAGGGAAGGGGTGGGTGG - Intronic
969473231 4:7402250-7402272 GTGGTGAGGGTGGGTGTGAGAGG - Intronic
969676836 4:8619011-8619033 GTGGGTATGGGGGGTGGGAGTGG + Intronic
971185889 4:24375643-24375665 ATGGTGGGAGGAGGTGTGAGGGG + Intergenic
971527459 4:27639036-27639058 GGGGTGGAGGGAGGTGGGAGGGG - Intergenic
971955745 4:33416367-33416389 GGGGGGTTGGGAGGTGTGAGGGG - Intergenic
972096809 4:35358147-35358169 ATGGGGATGGGAGGTTTGTGTGG - Intergenic
972169749 4:36331594-36331616 GTGGGAATGGGAGGAGTGTGAGG + Intronic
972731419 4:41798808-41798830 GTGGTGATAGGAAGGGTGAGGGG - Intergenic
973914095 4:55615770-55615792 GTGGAGGTGGGAGGAGGGAGAGG - Intronic
974181430 4:58388714-58388736 GTGGTGGGGGGAGGGGGGAGGGG - Intergenic
975001836 4:69234182-69234204 GTTGGGAGGTGAGGTGTGAGGGG - Intergenic
975003606 4:69257909-69257931 GTTGGGAGGTGAGGTGTGAGGGG + Intergenic
975199714 4:71572655-71572677 GTGGTGTTGGGTGGGGGGAGGGG + Intergenic
975983426 4:80183684-80183706 GTGGTGTGGGGAGGTGTGTGAGG - Intergenic
976465275 4:85360815-85360837 GTGGTGGTGGAAGGTTGGAGTGG + Intergenic
977507459 4:97920508-97920530 GTAGTGAGGGCAGGTGTCAGTGG + Intronic
978341109 4:107721614-107721636 TTGGTGATGGGCGGGGTCAGGGG - Intergenic
979113879 4:116796239-116796261 GTGGTGCTCTGAGGTGTGTGAGG - Intergenic
979430897 4:120629153-120629175 GTGGTTATTAGAGGTGGGAGGGG + Intergenic
980085454 4:128385968-128385990 TGGGTGAGGGGAGGAGTGAGGGG + Intergenic
980452359 4:132991239-132991261 GTGGTGATGGTGGGGGTAAGGGG - Intergenic
981045756 4:140263599-140263621 GAGGTGAGGAGAGGTGAGAGAGG + Intronic
981281476 4:142964825-142964847 ATGGTGATGGGAGTGGTGAAGGG + Intergenic
981550666 4:145937968-145937990 TTGGTGGGGGGAGGTGGGAGAGG - Intronic
981698151 4:147579892-147579914 GTGGTGGGTGGAGGTGAGAGGGG - Intergenic
981733638 4:147926060-147926082 GTGGTGTTGGTAGTGGTGAGTGG + Intronic
981972702 4:150684880-150684902 GTGGTGGTGGGAGTAGTGCGTGG - Intronic
983637664 4:169914568-169914590 GGGGTGATGGGAGATGGGAGGGG + Intergenic
984315092 4:178118849-178118871 GTGGTGGGGGGAGGGGGGAGGGG + Intergenic
984658160 4:182342456-182342478 CTGGGGGTGGGAGGGGTGAGGGG + Intronic
984746676 4:183227101-183227123 GTGGTGGTGGGAGGTATGCTAGG - Intronic
984887528 4:184463880-184463902 CTGGTAAAGGCAGGTGTGAGGGG + Intronic
985631819 5:1017877-1017899 GTGGTGCTGGGGTGTGAGAGAGG + Intronic
985792466 5:1937607-1937629 GTGCTGATGGGAAGTATCAGGGG - Intergenic
986990554 5:13547833-13547855 GTGGTGGGGGGATGTGTGAATGG - Intergenic
987067340 5:14303054-14303076 CTGGAGATGGGGGGTGTCAGTGG + Intronic
987067358 5:14303126-14303148 CTGGAGATGGGGGGTGTCAGTGG + Intronic
987067375 5:14303198-14303220 CTGGAGATGGGGGGTGTCAGTGG + Intronic
988081044 5:26416076-26416098 GTGGAGAGGCGAGGTGTGTGTGG + Intergenic
988149752 5:27362654-27362676 ATGGTGAGAGGAGGTGAGAGAGG + Intergenic
988171368 5:27661014-27661036 ATGGTAATGGGAGGTTTGTGGGG - Intergenic
988731423 5:33976577-33976599 GTGGAGGTTGGAGGGGTGAGGGG + Intronic
989085331 5:37670374-37670396 TTCACGATGGGAGGTGTGAGAGG + Intronic
989732308 5:44663726-44663748 GTGGTGAGGGGAGTTGTGAAGGG - Intergenic
990213202 5:53502645-53502667 GTGGTAATGGGGGGTGAGGGGGG + Intergenic
990827718 5:59920861-59920883 GTGGTGGGGGGAGGGGGGAGGGG + Intronic
992814260 5:80420437-80420459 GTGGTGTGGGGAGATGTGGGAGG - Intronic
992815521 5:80433436-80433458 GTGGTGTGGGGAGATGTGGGAGG + Intronic
992824669 5:80536917-80536939 GTGTTGGGGGGAGGTGTGAATGG + Intronic
993307431 5:86289935-86289957 GTGGAGAGGGGAGGAGAGAGAGG + Intergenic
993691959 5:91012861-91012883 GTGGAGGTGGGAGGAGGGAGAGG - Intronic
993881202 5:93363431-93363453 GTGGGGATGGGAGAAGGGAGGGG + Intergenic
994318356 5:98360597-98360619 GTGGTGATGGAGGCTGTGAGTGG + Intergenic
996337827 5:122403986-122404008 GAGGTGGGGGGTGGTGTGAGTGG - Intronic
996506652 5:124275571-124275593 GTGGAGATGGGGGCTGGGAGTGG - Intergenic
998006912 5:138663158-138663180 CTGGAGATAGGAGGGGTGAGTGG - Intronic
998385175 5:141753335-141753357 GTGGTGTTGGGAAGCGGGAGAGG + Intergenic
998411718 5:141916238-141916260 GTGGTGAAGGGAGGTGTAGCAGG - Intergenic
999253880 5:150198894-150198916 GTAGTGAGGGGAGGAATGAGGGG - Intronic
999494731 5:152085635-152085657 GTGGGGATGGGAGATGGGAAGGG + Intergenic
999600388 5:153256197-153256219 TTGGGGATTGGAGGTATGAGCGG + Intergenic
999885062 5:155913187-155913209 ATGGTGATGGGAGATGAGATGGG + Intronic
999942784 5:156562676-156562698 GTGGGGCTGGGAGCTGAGAGAGG + Intronic
1000203135 5:159031398-159031420 GTGGAGATGGGAGGTGAGGAGGG - Intronic
1000510138 5:162170723-162170745 GTGGGGTTGGGAGGAGGGAGAGG + Intergenic
1000608006 5:163344773-163344795 GGCGGGATGGGAGGTGTTAGAGG - Intergenic
1001094771 5:168767708-168767730 GTGGTGGTGGGAGGGGTCGGGGG + Intronic
1001537301 5:172507160-172507182 GGACTGATGGGAGGTTTGAGGGG + Intergenic
1001650155 5:173310286-173310308 CTGGAGAAGGGAGGTCTGAGCGG + Intergenic
1001953701 5:175833701-175833723 GTGGGGATGGGAGGCTGGAGAGG + Intronic
1003135720 6:3433423-3433445 GGAGTGATGGGAGGAGTGTGGGG - Intronic
1003403556 6:5810168-5810190 GTGGGGCTGGGAGGTGGGCGTGG + Intergenic
1003815875 6:9839647-9839669 GGGGTGGTGGGAAGTGTTAGGGG - Intronic
1004208863 6:13617247-13617269 GAAGTGATGGGAGGTGGGGGGGG - Intronic
1004301704 6:14464278-14464300 CTGGTGGTGGGTGGTGAGAGTGG - Intergenic
1005049167 6:21667389-21667411 GGGGTGATGGAAAGTGAGAGAGG - Intergenic
1006187479 6:32189519-32189541 GGGGTGAAGGGAGGTTTGAGAGG + Intronic
1006265251 6:32916252-32916274 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1006319610 6:33312864-33312886 CAGGTGATGCGAGGTGGGAGGGG - Intronic
1006359080 6:33577496-33577518 ATGGTTATGGGATGGGTGAGGGG + Intronic
1006389403 6:33749658-33749680 CCGGGAATGGGAGGTGTGAGGGG + Intergenic
1006389772 6:33751526-33751548 CCGGGAATGGGAGGTGTGAGGGG + Intergenic
1006438347 6:34038672-34038694 GTGGTGGGGGGAGGTGAGATGGG - Intronic
1006460310 6:34154253-34154275 GCGGTGAGGGGAGGTGTGTGCGG - Intronic
1006572876 6:35019861-35019883 GTGGAGACAGGAGGTGTGAGAGG + Intronic
1006811520 6:36823313-36823335 GTGGTGATGATAGGGGTGGGAGG - Intronic
1006856527 6:37137555-37137577 GTGGGGTTGGGAGGTGGGAGCGG - Intergenic
1007320813 6:41027865-41027887 GTGGTTAGGGGAGGTGGGTGTGG - Exonic
1007373070 6:41439549-41439571 GTGGGGCTGGGAGGTAGGAGGGG - Intergenic
1007385281 6:41516366-41516388 GTGATGGTGGGAAGTGTGCGGGG + Intergenic
1007631806 6:43276933-43276955 GTGGGGAGGGAAGGGGTGAGTGG + Intronic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1008033662 6:46723982-46724004 GTGGGGATGGAAGGTGGGTGTGG - Intronic
1010168196 6:72941625-72941647 GTGGGGAAGGGAGGAGGGAGGGG - Intronic
1010478029 6:76313548-76313570 AAGGTGGTGGTAGGTGTGAGAGG + Intergenic
1010865194 6:80967794-80967816 GTGGTGGTGGGAAGGGTGAGGGG + Intergenic
1012256271 6:97036549-97036571 GTGATGATGGGTGGGGTGTGTGG + Intronic
1013046308 6:106488936-106488958 CTGGGGATGGGAGGTGTCAAGGG + Intergenic
1013308940 6:108875346-108875368 GAGGTGATTAGAGGGGTGAGGGG - Intronic
1013366600 6:109442085-109442107 GTGGGGAAGGGAGGTGGAAGAGG - Intronic
1014051426 6:116959696-116959718 GTGTTGAGGGGAGGTATGGGAGG + Intergenic
1014762808 6:125376466-125376488 GTGGTGTTGGGTGGTGTGGTGGG + Intergenic
1015384909 6:132610837-132610859 TTGGTGATGGGAGGTGTGCAGGG + Intergenic
1015668298 6:135657227-135657249 ATTGTGATGGGAGGTTGGAGAGG + Intergenic
1016904142 6:149132334-149132356 TTGGTTATGGGAGGGGGGAGTGG - Intergenic
1016940281 6:149477621-149477643 GTGCTGATGGAGGGTGTGGGTGG - Intronic
1017186463 6:151605675-151605697 GTGGTGCTGGGAAGGTTGAGGGG + Intronic
1018003884 6:159602850-159602872 GTGGGGCTGCGAGGTGGGAGGGG - Intergenic
1018094858 6:160376359-160376381 GTGGTGCGGAGAGGGGTGAGGGG + Intronic
1018128720 6:160707265-160707287 ATGGAGATGGGAGGGGTCAGGGG + Intronic
1018429850 6:163713938-163713960 GTGGGGATGGGAGGGCAGAGGGG + Intergenic
1019335697 7:481571-481593 GTGGGGAGGGGAGGAGTGTGGGG - Intergenic
1019517594 7:1446638-1446660 GAGGCGATGGGAGCTGTGGGAGG + Intronic
1019795039 7:3043111-3043133 GTGGAGCTGGGAGATGGGAGAGG - Intronic
1020135647 7:5586526-5586548 GTGGTTCAGGGAGGAGTGAGTGG + Intergenic
1020241645 7:6399683-6399705 TTGGTGCTGGGAGCTGTGACAGG + Intronic
1020442634 7:8234442-8234464 GTGGTGATGGGATGGGGTAGAGG - Intronic
1020905827 7:14062982-14063004 GGGGTGAGGGGAGGGGGGAGGGG - Intergenic
1021620863 7:22550068-22550090 GTGGTGATGGCGGGGGTGTGTGG + Intronic
1021704321 7:23351746-23351768 GTGGTGGTGCGGGGTGGGAGAGG - Intronic
1021952573 7:25789720-25789742 GTTGTGAAGGGAGGTGGGATAGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022095121 7:27135435-27135457 GTGGTGGTGGAAGGGGTGAAGGG + Intronic
1022300509 7:29098143-29098165 GTGTTGTTGGAAGGTCTGAGTGG + Intronic
1022528821 7:31054306-31054328 GTGGTGAGGGGAGGTGTCTGTGG + Intronic
1022961347 7:35429767-35429789 GTGGTCTTGGGAGGGGTCAGTGG - Intergenic
1023062705 7:36343508-36343530 GGGGAGATGGGAGGGGAGAGGGG + Intronic
1023518460 7:41027199-41027221 GTGAGGATGGGAGGTTTTAGAGG - Intergenic
1023590268 7:41774028-41774050 TTGGGGGTGGGAGGTGGGAGAGG + Intergenic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1024098289 7:46003942-46003964 GTGGCCATGGGAGGGGTGGGTGG + Intergenic
1024135430 7:46402513-46402535 GTGGAGATGGGAGGAGGGAGAGG + Intergenic
1025854752 7:65267207-65267229 GTGGAGATAGGATGGGTGAGGGG + Intergenic
1027185075 7:75966215-75966237 GAGGTGAAAGCAGGTGTGAGTGG - Intronic
1027318415 7:76998140-76998162 GTGGAGTTGTGAGGTGTGGGTGG + Intergenic
1027885123 7:83894350-83894372 GGGGGAAGGGGAGGTGTGAGTGG + Intergenic
1028174223 7:87634480-87634502 GTGGTGGTGGGGGGTGGGGGGGG + Intronic
1028185813 7:87784715-87784737 GTGGTGAGGGGAGATGTGGTTGG + Intronic
1028216494 7:88139807-88139829 GTGGTGCTGGGAGGCATGATCGG + Intronic
1029451277 7:100642866-100642888 GTTGTGGTGGGAGGTGGGAGGGG - Intergenic
1029544051 7:101201119-101201141 GTGGGGCTGGGAGGCGTAAGGGG + Intergenic
1030654160 7:112147948-112147970 GGGGTGATAGGAGGCCTGAGGGG - Intronic
1032125167 7:129188535-129188557 GTGGGGAGGGGAGGCGAGAGAGG - Intergenic
1032551327 7:132787053-132787075 GTGGGACTGGGAGGAGTGAGGGG + Intronic
1034030985 7:147763370-147763392 GTGGTGTTGGGAGAAATGAGAGG + Intronic
1034051594 7:147989831-147989853 GGGCTGTAGGGAGGTGTGAGTGG - Intronic
1034169394 7:149051054-149051076 GTGGTGATGAGAGGTGTTATTGG - Intergenic
1034440460 7:151083309-151083331 GGGGTGATGAGAGGTGGGGGTGG - Intronic
1034570276 7:151950256-151950278 GTGGGGATGGGAAGTTTCAGGGG - Intergenic
1034716905 7:153251839-153251861 GTGGTGCTGGGGGGTGTGCCTGG - Intergenic
1034992052 7:155554096-155554118 GTGGAGATGGGATGTGAGAAGGG + Intergenic
1036752128 8:11449980-11450002 GTGGTGAGAGGAGGTGTGGAGGG - Intronic
1036788216 8:11701857-11701879 GGGGTGGTGGGAGGTGGTAGGGG + Intronic
1036910521 8:12754539-12754561 GGGGTGCTGGGGGGTGTGGGAGG - Intronic
1037021814 8:13982234-13982256 GTGGTTACCGGATGTGTGAGAGG + Intergenic
1037469257 8:19191412-19191434 ATGGTGAGGGGGGGTGAGAGAGG - Intergenic
1037674848 8:21043605-21043627 GGGGTGGTGGGAGGTGGGGGGGG - Intergenic
1038417039 8:27404620-27404642 GTGGTGAGGACAGGTGTGTGTGG - Intronic
1038438763 8:27557340-27557362 CTAGTGTTGGGGGGTGTGAGTGG - Intergenic
1039464063 8:37770893-37770915 AAGGTGATGGGAGGAGGGAGCGG + Intronic
1039911993 8:41833324-41833346 GTGGTGATAGCAGGTGTCTGGGG + Intronic
1039947304 8:42140810-42140832 GTGGTGCTGTTGGGTGTGAGGGG - Intergenic
1042849027 8:73197567-73197589 TTGGTGAAGGGAGGTGAGGGTGG - Intergenic
1043008036 8:74844983-74845005 GTGGTGATGGTGATTGTGAGGGG + Intronic
1043064788 8:75555046-75555068 CAGGTGATGGGAGGCGTGAGAGG - Intronic
1043099678 8:76026532-76026554 GTGGTGATGGGAAGTTTCATGGG + Intergenic
1043444014 8:80301534-80301556 GTGGTGGTGGGGGGTGAGGGGGG - Intergenic
1043716492 8:83493813-83493835 GGGGTGATGGGAGAGGGGAGGGG - Intergenic
1043766953 8:84147624-84147646 GTGGTAAATGAAGGTGTGAGAGG - Intergenic
1043842778 8:85128421-85128443 GTGGTGGTGGGGGGGGTGGGGGG - Intronic
1044493334 8:92846900-92846922 GGGGTGAGGGGAGGGGGGAGGGG - Intergenic
1045047016 8:98288878-98288900 GTTGTGATGGGAGGAGGGAAAGG - Intronic
1045080500 8:98620317-98620339 GGGGTGAGGGGAGGGGGGAGGGG + Intronic
1048363955 8:133722034-133722056 GTGTTAATTAGAGGTGTGAGAGG + Intergenic
1048415432 8:134223231-134223253 TTGGTGATGGGAGATGAGACTGG - Intergenic
1048890205 8:138940452-138940474 GGGGAGGTGGGAGGCGTGAGTGG - Intergenic
1049537666 8:143189676-143189698 GTGGGGGTGGGGGGTGGGAGTGG - Intergenic
1049537688 8:143189719-143189741 GTGGGGGTGGGGGGTGGGAGTGG - Intergenic
1049543219 8:143218020-143218042 GTGGTGTTGGGTGGTGTTGGGGG - Intergenic
1049543257 8:143218121-143218143 GTGGTGTTGGGTGGTGTTGGGGG - Intergenic
1050416365 9:5421416-5421438 GTGGTGATGAGTTCTGTGAGGGG - Intronic
1051825326 9:21212331-21212353 CTGGTGATGTGAGGGGTGGGTGG - Intronic
1053148584 9:35728620-35728642 GTCGTGATGGGATCTGTGTGGGG - Intronic
1053150599 9:35740506-35740528 CTGGTGATGGGGGGTCTGACTGG - Exonic
1053329367 9:37188946-37188968 GAGGAGATGGGAGGAGAGAGGGG - Intronic
1053696667 9:40645564-40645586 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1054307917 9:63444795-63444817 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1054720655 9:68600363-68600385 GTGATGATGGTGGGTGTGGGGGG - Intergenic
1054825414 9:69567973-69567995 GTGGTGATGGGAGTTTTCTGGGG - Intronic
1054945765 9:70794508-70794530 ATGGAGATGGGAGTGGTGAGGGG - Intronic
1055419228 9:76119934-76119956 GTGGTGATGGGAAGTGCTGGGGG - Intronic
1057226546 9:93296137-93296159 GTGGTGAGGGGAGGAAGGAGAGG - Intronic
1057226611 9:93296316-93296338 GTGGTGAGGGGAGGAAGGAGAGG - Intronic
1057230280 9:93317639-93317661 GTGGGGTTGGGAGGTTGGAGAGG - Intronic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1057762834 9:97890442-97890464 GTGGTGAAGGTAGGAGTGAAGGG - Intergenic
1058050561 9:100402044-100402066 GTGGGGATGGGAGGTGGGGAAGG - Intergenic
1059718555 9:116936275-116936297 GTGGTGATGGTGGGTGGTAGTGG - Intronic
1060158617 9:121338828-121338850 GTGGTGGTGGAGGGTGTGTGTGG + Intergenic
1060549655 9:124478894-124478916 GGGGTGACGGTTGGTGTGAGTGG + Intergenic
1061213130 9:129204808-129204830 GGGGTGCGGGGAGGGGTGAGGGG + Intergenic
1062311604 9:135940925-135940947 GTGGTGCTGGGAGCTGTGTGGGG - Intronic
1062358615 9:136176989-136177011 GTGGTCAGGGGAGGTCTTAGCGG + Intergenic
1202779118 9_KI270717v1_random:19209-19231 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1185462681 X:339994-340016 GAGGAGATGGGGGGGGTGAGAGG + Intronic
1185462692 X:340018-340040 GAGGAGATGGGGGGGGTGAGAGG + Intronic
1185462703 X:340042-340064 GAGGAGATGGGGGGGGTGAGAGG + Intronic
1185462724 X:340089-340111 GAGGAGATGGGGGGGGTGAGAGG + Intronic
1185511576 X:668114-668136 GAGGGGATGGGAGGGGGGAGTGG - Intergenic
1186407109 X:9313751-9313773 GTGGTGATGGGAAGTGGATGGGG + Intergenic
1186697638 X:12054160-12054182 GGGGAGAGGGGAGGTGAGAGTGG + Intergenic
1187072696 X:15903884-15903906 GTGGGGATTGGGGGTGGGAGAGG - Intergenic
1187646829 X:21356587-21356609 GTTGTGCTGGGATGTGAGAGAGG - Intergenic
1188057947 X:25563404-25563426 ATGGTGATGGGAGGAGCAAGGGG + Intergenic
1188798472 X:34496149-34496171 GGGGTGAGGGGAGGGGGGAGGGG + Intergenic
1189383966 X:40521599-40521621 GGGGAGTTGGGAGGTGGGAGGGG + Intergenic
1189693796 X:43643030-43643052 GTGGAGATGGGAGGCATGAAAGG + Intergenic
1189909170 X:45792710-45792732 ATGGGGGTGGGAGGGGTGAGGGG - Intergenic
1190068793 X:47262234-47262256 GTGGTTATGGGAGGTAGGAATGG - Intergenic
1190301070 X:49057875-49057897 GTGGTGGTGGGCGGGGTGAGGGG + Intronic
1190455389 X:50622692-50622714 GTGGTGGGGGAAGGTGTGAAGGG + Intronic
1190631720 X:52393724-52393746 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1190890081 X:54560108-54560130 TGGGGGATGGGAGGTGTGCGTGG + Intronic
1190935729 X:54997617-54997639 GTGGAGAGTGAAGGTGTGAGGGG + Intronic
1192935105 X:75850750-75850772 GAGGTGATGGGAGGGGTTATGGG + Intergenic
1194358083 X:92913421-92913443 GTGGTGAGGGGAGCTGGGAGAGG - Intergenic
1195732858 X:107982838-107982860 GGGGTGATGGGAGGAGTGTGGGG - Intergenic
1196566368 X:117210046-117210068 GTGGTGATGTAAGGGGTGACAGG - Intergenic
1196871414 X:120116238-120116260 GTGGAGATGGGAGGTGTGGGTGG + Intergenic
1197518197 X:127462997-127463019 GTGAGGATGGGAGGAGAGAGAGG + Intergenic
1197674263 X:129312724-129312746 GTGGTGATGGGTGGAGCTAGAGG + Intergenic
1197756414 X:129998361-129998383 GTGGTGGGGGGAGGTGGGAAGGG + Intronic
1197980725 X:132216537-132216559 GGGGTGTTGGGGGGTGGGAGGGG + Intronic
1198087374 X:133293891-133293913 GTGGTGGTGGGATGGGTGTGGGG - Intergenic
1198783518 X:140261682-140261704 ATGGTGGTGGGAGAGGTGAGAGG + Intergenic
1200666267 Y:6029072-6029094 GTGGTGAGGGGAGCTGGGAGAGG - Intergenic
1200837844 Y:7750212-7750234 GTGGTGACGGTAGGTGTGTGGGG + Intergenic
1201479010 Y:14417109-14417131 GTGAGGATGGGAGGAGGGAGAGG + Intergenic
1202598331 Y:26567017-26567039 GTGGGGTTGGGGGGTGTGAGTGG - Intergenic