ID: 959638160

View in Genome Browser
Species Human (GRCh38)
Location 3:108599636-108599658
Sequence ATTTCAACACTGAATGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959638160_959638170 7 Left 959638160 3:108599636-108599658 CCCCCCTCATTCAGTGTTGAAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 959638170 3:108599666-108599688 CCCAATGTGATAGTATTAGGAGG 0: 16
1: 220
2: 940
3: 2123
4: 3378
959638160_959638173 12 Left 959638160 3:108599636-108599658 CCCCCCTCATTCAGTGTTGAAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 959638173 3:108599671-108599693 TGTGATAGTATTAGGAGGTTGGG 0: 1
1: 45
2: 433
3: 1438
4: 2890
959638160_959638174 19 Left 959638160 3:108599636-108599658 CCCCCCTCATTCAGTGTTGAAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 959638174 3:108599678-108599700 GTATTAGGAGGTTGGGCCTTTGG 0: 7
1: 235
2: 984
3: 2083
4: 2876
959638160_959638166 4 Left 959638160 3:108599636-108599658 CCCCCCTCATTCAGTGTTGAAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 959638166 3:108599663-108599685 ACCCCCAATGTGATAGTATTAGG 0: 12
1: 207
2: 945
3: 2100
4: 3416
959638160_959638175 20 Left 959638160 3:108599636-108599658 CCCCCCTCATTCAGTGTTGAAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 959638175 3:108599679-108599701 TATTAGGAGGTTGGGCCTTTGGG 0: 4
1: 269
2: 1177
3: 2373
4: 3307
959638160_959638172 11 Left 959638160 3:108599636-108599658 CCCCCCTCATTCAGTGTTGAAAT 0: 1
1: 0
2: 1
3: 13
4: 176
Right 959638172 3:108599670-108599692 ATGTGATAGTATTAGGAGGTTGG 0: 26
1: 315
2: 1180
3: 2528
4: 4083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959638160 Original CRISPR ATTTCAACACTGAATGAGGG GGG (reversed) Intronic
902210085 1:14898751-14898773 ATTTCAAGACTCTAAGAGGGCGG + Intronic
904155063 1:28476141-28476163 ATTTCTTCACTGAATGTGGATGG - Exonic
905433660 1:37942581-37942603 ATTACATCACTGATTGAGAGAGG + Intronic
905819889 1:40980665-40980687 AATTCAACAAAGACTGAGGGGGG - Intronic
906932979 1:50187797-50187819 TTTTCAACAATTAATGAGGCTGG + Intronic
911815067 1:102339092-102339114 AATTCACCACTGGATCAGGGAGG - Intergenic
912371215 1:109175489-109175511 ATTTCACCACTGACTGGGTGTGG - Intronic
914863596 1:151406800-151406822 ATCTCAACAGTGAATGAGTGAGG + Intronic
915445124 1:155970197-155970219 AGATCAACACTGAAGGATGGAGG - Intronic
920797150 1:209150456-209150478 ATTTCAAAACTCAATGAAGATGG + Intergenic
921525372 1:216210607-216210629 ATTACAAGACTGAATGAAGGAGG - Intronic
923057342 1:230436947-230436969 ATTTCAACACTGATTTATGTTGG - Intergenic
923440760 1:234017941-234017963 ATTTCACCACTCAATTTGGGGGG + Intronic
1065668353 10:28086998-28087020 ATTTCAACACGCAATTTGGGGGG - Intronic
1066023401 10:31325661-31325683 ATTTTAAATCTGAATGGGGGAGG - Intronic
1067836304 10:49643867-49643889 ATATCAGCACTCACTGAGGGTGG - Intronic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1073731524 10:106293960-106293982 ATTACAACCCTCAATGATGGAGG + Intergenic
1078604348 11:12761931-12761953 CTTTAAGCACTGAATGGGGGTGG + Intronic
1079775027 11:24514452-24514474 ATTACAGCACAGAATGAGGAAGG + Intronic
1082266417 11:50123459-50123481 ATATAAACATTGAATGAGGAGGG + Intergenic
1082289672 11:50355109-50355131 ATATAAACATTGAATGAGGAGGG - Intergenic
1088925916 11:114302741-114302763 ATTTCAACACAGAAATTGGGAGG - Intronic
1089009415 11:115120507-115120529 ATTGTTACAATGAATGAGGGGGG - Intergenic
1090188401 11:124752578-124752600 ATTTCACCACTTACTGAGGTAGG + Intronic
1093632726 12:21429473-21429495 ATTTCAACACTTTGGGAGGGAGG - Intergenic
1101612763 12:106306155-106306177 ATTTCAAAACTGCAAGAGGTTGG + Intronic
1104037115 12:125105165-125105187 ATTTCAACACGAGATGAGGGTGG + Intronic
1105530511 13:21214938-21214960 ACTTCAACAGTGAATTTGGGGGG - Intergenic
1107432560 13:40352941-40352963 ATTTCCACACTGCATGAGGAAGG - Intergenic
1108385804 13:49898361-49898383 ATTCCAACACCAAATGAGAGAGG + Intergenic
1108908281 13:55507397-55507419 CTTTCAACACTGTTTGATGGAGG - Intergenic
1112198374 13:97248995-97249017 ATTTCAACTCACAATGAGTGGGG - Intronic
1112348076 13:98609445-98609467 CTTTCAACACAGAATGCGGCCGG + Intergenic
1112659359 13:101490061-101490083 ATTTCAACACAGAATTTTGGGGG - Intronic
1112689078 13:101869270-101869292 ATTCCAAAACTAAATGACGGTGG + Intronic
1113362359 13:109643238-109643260 CTTTCATCAGTGAATGAGGAAGG - Intergenic
1113589451 13:111488232-111488254 ATTTCACCATTGAAAGATGGCGG - Intergenic
1116527228 14:45919908-45919930 ATTAGAAGACTGAATGAAGGAGG + Intergenic
1117815321 14:59592079-59592101 ATTACGAGACTGAATGAAGGGGG - Intergenic
1119181250 14:72606678-72606700 ATTTCAACACGGAATTTGGTGGG - Intergenic
1119318805 14:73717533-73717555 ATAGCAACACTGAAAGAGCGTGG - Exonic
1120818077 14:88883941-88883963 ATTACAAGGCTGAATGAAGGGGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1123965941 15:25457868-25457890 AATTCATCAGTGAATGATGGGGG - Intergenic
1124783824 15:32660404-32660426 ATGTCCAAACCGAATGAGGGAGG - Intronic
1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG + Intergenic
1129473688 15:75768910-75768932 ATTTCAACACGAAATGTGGATGG - Intergenic
1129731934 15:77937309-77937331 ATTTCAACACTAGATGTGGATGG - Intergenic
1130404623 15:83587184-83587206 AATTCAAAACAGAATGAGGCAGG - Intronic
1131999487 15:98164398-98164420 CTCTCAACACTGGTTGAGGGCGG - Intergenic
1132107184 15:99071403-99071425 ATTTCAACCCTGGGTGGGGGGGG + Intergenic
1134861468 16:17564225-17564247 ATTTAAACACTGAAATAGTGTGG + Intergenic
1135922031 16:26659515-26659537 ATTTCAAAACTGAAGGACTGAGG - Intergenic
1136563212 16:31053479-31053501 CTTTCTAAACTGAAAGAGGGTGG - Intergenic
1137901597 16:52274699-52274721 GTTTCTCCACTGAAGGAGGGAGG + Intergenic
1150490099 17:65568480-65568502 ATTGCAGCACTGCGTGAGGGGGG - Intronic
1151063896 17:71128911-71128933 AGCTGAACACTGAATGTGGGAGG + Intergenic
1155872918 18:31049445-31049467 ATCTCAAGGCTGGATGAGGGAGG + Intergenic
1155998608 18:32359069-32359091 ATTTCAAAACTGTATGTGGTAGG + Intronic
1157211522 18:45746649-45746671 ATTTCAACAATGAATGAAATTGG + Intronic
1159270463 18:66142429-66142451 CATTCCACACTGAATGGGGGAGG + Intergenic
1160047540 18:75400758-75400780 ATTTGAACACTACATGGGGGAGG - Intergenic
1163526961 19:17827267-17827289 GTTTTAAAACTGAATGAGTGCGG - Intronic
1163944675 19:20524016-20524038 ATTTCCTCACGGAGTGAGGGCGG + Intergenic
1164760736 19:30726564-30726586 ACTTCAGCAATGAATGAAGGAGG + Intergenic
1167133737 19:47604406-47604428 TTTTCTACACTGTATGATGGGGG + Intergenic
1168567649 19:57438494-57438516 ATTACGAGACTGAATGAAGGGGG - Intronic
925098200 2:1224198-1224220 ATTTCAACACTGAACGTTTGGGG + Intronic
926933869 2:18067505-18067527 ATTTCAACACATAATTTGGGAGG - Intronic
927474408 2:23401463-23401485 AATTCATCTCTGAATGAGGTTGG + Intronic
927549523 2:23985693-23985715 TTTTAAACATTGAATGAGGTAGG + Intronic
932056887 2:68454636-68454658 CTTTCAACACTGGAGGAAGGTGG - Intergenic
934661533 2:96145920-96145942 ATTTCTACACTGGATGATGGGGG + Intergenic
935235397 2:101134106-101134128 ATTTCAACAATGAATTTGGAGGG + Intronic
939389391 2:141546633-141546655 ATATCAATAATGAATGAGGAAGG + Intronic
940211880 2:151263432-151263454 ATTTTAAAACAGAATGAGGTAGG + Intergenic
944061815 2:195577683-195577705 ATTTGAACATACAATGAGGGAGG - Intronic
944390811 2:199217624-199217646 ATTTCAACACGAAATTTGGGTGG - Intergenic
944408404 2:199412027-199412049 AATTCAGCTCTGAAGGAGGGTGG + Intronic
945954212 2:216070571-216070593 ATTACGACACTGAACGAAGGAGG + Intronic
947293958 2:228610029-228610051 ATTTTCACGCTGAATGAGAGGGG + Intergenic
947889940 2:233608456-233608478 ATTTCAACACTTGATTTGGGAGG + Intergenic
947895364 2:233666312-233666334 ATTTCAACACTTGATTTGGGAGG + Intronic
947925544 2:233918993-233919015 CTTTGCACACTGAATGAGAGAGG - Intronic
1169580187 20:7013598-7013620 GTTTCAAAAGTGAATGAGTGAGG + Intergenic
1169915448 20:10678200-10678222 ATTTTAAGAGTGAATGAGGCTGG + Intergenic
1169922797 20:10753489-10753511 ATGTTAATACTGAATCAGGGAGG + Intergenic
1170676492 20:18486283-18486305 ATTCCAACTCTCACTGAGGGTGG - Intergenic
1173281734 20:41634445-41634467 ATTTCAGAAATGAATGAGGAAGG - Intergenic
1174103697 20:48147085-48147107 GTTTCACCACTGCATGTGGGGGG + Intergenic
1174222234 20:48965564-48965586 TTTTCAAAAGTGAATGGGGGTGG + Intronic
1179511659 21:41878059-41878081 ATGTCAACACTCGATAAGGGTGG - Intronic
1180198704 21:46212321-46212343 ATTTCCACACTGAATCAGGTGGG + Intronic
1180943876 22:19679108-19679130 ATTTCAACAACGAATGTTGGAGG - Intergenic
951409216 3:22341977-22341999 ATTAAAAGACTGAATGAGGCCGG + Intronic
951666926 3:25136735-25136757 ATTTCAACACCAAAGGATGGGGG + Intergenic
952553799 3:34508796-34508818 ATTTGAACTCAGAAAGAGGGTGG + Intergenic
956908243 3:73789546-73789568 ATATAAACATTGAATGAGGAGGG + Intergenic
956949461 3:74264585-74264607 ATTTCAACAAAGAATTTGGGGGG - Intronic
957023795 3:75155525-75155547 ATCTCAATACTGAATGATGTTGG - Intergenic
957746995 3:84358252-84358274 AGTACTACACTGAATGAGAGTGG + Intergenic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
960361637 3:116719194-116719216 GTTTCTACACTGAATTAGGAGGG - Intronic
960862946 3:122169793-122169815 ATTACAAGACTGAATGAAGGGGG + Intergenic
963202302 3:142598018-142598040 ACTTCAATACGGAAAGAGGGAGG - Intronic
964041350 3:152266375-152266397 ACTTCAACACTGGAGGAGGGGGG - Intronic
966931081 3:184676081-184676103 AAATCAGCACTGAATGAGGAAGG - Intronic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
969440405 4:7213513-7213535 AGATCAACACTGAATGAGTGTGG - Intronic
972258549 4:37384861-37384883 ATTCCAACCCTGACTTAGGGTGG - Intronic
972394172 4:38644065-38644087 AATTCAAGAATGAAGGAGGGTGG + Intergenic
972770029 4:42189194-42189216 ATGTCAACCCTGAGTAAGGGTGG - Intergenic
975192876 4:71486484-71486506 ATTTCAACAGTGTATGAGAAAGG - Intronic
975417608 4:74123217-74123239 ATTGCAACACTAAATGTGTGTGG - Intronic
976521891 4:86037717-86037739 ATTTGAAAATTGAATAAGGGTGG - Intronic
979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG + Intronic
979402618 4:120267197-120267219 ATCTCAACATTGACTGAGGATGG - Intergenic
983627741 4:169819290-169819312 ATTACAAGACTGAACGAGGCCGG + Intergenic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
984211819 4:176859182-176859204 ATTTCAAAAGTGACTGAGGTTGG + Intergenic
987590431 5:19918814-19918836 ATTTCACCTCTGAATGACAGAGG + Intronic
987791667 5:22576173-22576195 ATATCAGCACTGAATGAAGCAGG - Intronic
988402793 5:30783470-30783492 ATTTAAACAATGAAATAGGGAGG + Intergenic
988933334 5:36058785-36058807 ATTACGAGACTGAATGAAGGAGG - Intronic
989330771 5:40255406-40255428 ATTTTAGCACCTAATGAGGGAGG + Intergenic
990025091 5:51178407-51178429 ATGTCAACACACAATAAGGGAGG + Intergenic
993583618 5:89695583-89695605 ATTTCAAGTTTGAATGAGAGAGG + Intergenic
995377090 5:111486671-111486693 ATTTCAACACTAGAGTAGGGCGG + Exonic
995483366 5:112614733-112614755 ATTTCAACATGGGATGGGGGTGG - Intergenic
995825898 5:116298747-116298769 ATAACCACACTGAAGGAGGGAGG - Intronic
996535992 5:124578402-124578424 AATTCAAAATTGGATGAGGGTGG + Intergenic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997739490 5:136241125-136241147 ATTTCCATACTTTATGAGGGAGG - Intronic
999962910 5:156776182-156776204 ATTTAAACACTGAGTGGGGATGG - Intergenic
1000175822 5:158752598-158752620 ATTTCGTTACTGAGTGAGGGAGG + Intronic
1001838054 5:174848729-174848751 ATTACAATATTTAATGAGGGGGG + Intergenic
1002936228 6:1675468-1675490 AGTGCAACACTGAATCATGGTGG + Intronic
1003016885 6:2475246-2475268 ATAGTAACACTGGATGAGGGCGG + Intergenic
1003400935 6:5790309-5790331 ACTTCAACAGTGAATTTGGGGGG + Intergenic
1003604428 6:7546120-7546142 ATTGCACCAGTGAAGGAGGGAGG + Intronic
1005270187 6:24155362-24155384 AGCTCAACTCTGATTGAGGGAGG + Intergenic
1005297734 6:24443146-24443168 ATTACAAGACTGAACGAAGGAGG + Intronic
1006528091 6:34625672-34625694 ATTTCTAAACTGAAAGAAGGTGG - Intronic
1008929316 6:56921091-56921113 ATTTGAACAATGAATGAGAAAGG + Intronic
1010053695 6:71538724-71538746 ATTTCAAGAATGATTTAGGGAGG + Intergenic
1011075927 6:83438541-83438563 AATGCAACTCTGAATTAGGGAGG + Intergenic
1012807406 6:103911850-103911872 AGTTCAACACTCTATGAGGGAGG + Intergenic
1013342254 6:109226373-109226395 ATTTCTACAATAAATTAGGGAGG - Intergenic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1018224441 6:161614811-161614833 ATTTCAAGATTGATTAAGGGTGG - Intronic
1019504764 7:1385363-1385385 AGCCCAACACTGAAGGAGGGAGG + Intergenic
1020934207 7:14439970-14439992 ATTACAAGACTGAATGAAGGAGG + Intronic
1021855960 7:24856084-24856106 ATTTGAACACTCAATGAAAGAGG - Intronic
1026340788 7:69432220-69432242 ATTACGAGACTGAATGAAGGGGG + Intergenic
1026641341 7:72128507-72128529 ATTTTAAGAGTGAATAAGGGAGG + Intronic
1028341809 7:89731643-89731665 ATTACAAGACTGAACGAAGGGGG + Intergenic
1029111863 7:98216862-98216884 ATTTCAAAAGTGAAGGAAGGAGG - Exonic
1030384870 7:108856522-108856544 CTGTAAACAGTGAATGAGGGAGG - Intergenic
1037595355 8:20350004-20350026 ATTTCAGCTATGAGTGAGGGGGG + Intergenic
1037856700 8:22376539-22376561 ATTTCCACACTGAAAAAAGGTGG + Intronic
1038321030 8:26527602-26527624 ATTTCAAAAATGAATTGGGGGGG + Intronic
1038410787 8:27357612-27357634 TTGTCAACTCTGAATGAGAGAGG + Intronic
1038434254 8:27523776-27523798 ATTTCCACTTTGAATGAGAGAGG - Intronic
1038825310 8:30992777-30992799 ATTTTCACACTGAAAGATGGTGG + Intergenic
1040388417 8:46930113-46930135 TGCTCAACACTGAGTGAGGGAGG - Intergenic
1040665810 8:49631432-49631454 AAATAAACACTGAATGAGGTTGG + Intergenic
1040769898 8:50960871-50960893 ACTTCAGCACTGAAGGAAGGTGG + Intergenic
1041518848 8:58732529-58732551 ATACCAACACTGAATCAAGGTGG - Intergenic
1041542639 8:59003530-59003552 TTTTCAACAGTGAAAGACGGGGG + Intronic
1041807669 8:61870887-61870909 ATCTCGGCACTGGATGAGGGAGG + Intergenic
1043620509 8:82186285-82186307 ATTTAAACACTGAGTGGGGAGGG + Intergenic
1044722441 8:95164048-95164070 ATGTCAGCTCTGAAGGAGGGAGG - Intergenic
1045901917 8:107292019-107292041 ATTTGAACACTGCCTGAGAGGGG - Intronic
1047542695 8:125785576-125785598 ATTGCAACACTGAAACAGGGAGG - Intergenic
1048180312 8:132188550-132188572 ATTACATCACTGAATAATGGAGG - Intronic
1050998996 9:12256910-12256932 ATTGCACCATTGAATGGGGGTGG + Intergenic
1051468871 9:17411914-17411936 ATTTCAATGCTGAATGGAGGTGG - Intronic
1052963457 9:34319936-34319958 ATATGAACACTGATTGAGGCAGG - Intronic
1058207261 9:102124488-102124510 ATTTGAAAAGTGAATGAGGCAGG + Intergenic
1059551044 9:115229418-115229440 ATTACAAGACTGAACGAAGGAGG + Intronic
1186281863 X:8001740-8001762 ATCTTACCACTGAATAAGGGAGG - Intergenic
1189589976 X:42500460-42500482 ATTTCAAGACTGAGTGAGGGCGG - Intergenic
1191014546 X:55794497-55794519 ATCTCAGTACTGAATGAAGGAGG + Intergenic
1193912684 X:87325279-87325301 ATTTCAAAACTGAAGGAGGTGGG + Intergenic
1194749137 X:97665060-97665082 ATCTCAACAGTTAATGAGGCAGG + Intergenic
1196506827 X:116455924-116455946 ATTTTATCTCTTAATGAGGGAGG + Intronic
1197675478 X:129325392-129325414 ATTTTAACAATGCATCAGGGAGG + Intergenic
1200479423 Y:3682266-3682288 ATTTCAACACTTGGGGAGGGCGG + Intergenic
1201440093 Y:13999012-13999034 ATCTTACCACTGAATAAGGGAGG - Intergenic
1201444478 Y:14043696-14043718 ATCTTACCACTGAATAAGGGAGG + Intergenic