ID: 959638700

View in Genome Browser
Species Human (GRCh38)
Location 3:108606210-108606232
Sequence GGCCCACTGAACCACTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959638700_959638704 11 Left 959638700 3:108606210-108606232 CCTGCTGAGTGGTTCAGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 88
Right 959638704 3:108606244-108606266 ACATTCTCTTTTCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 27
4: 352
959638700_959638705 12 Left 959638700 3:108606210-108606232 CCTGCTGAGTGGTTCAGTGGGCC 0: 1
1: 0
2: 1
3: 4
4: 88
Right 959638705 3:108606245-108606267 CATTCTCTTTTCTCCAAGCAGGG 0: 1
1: 0
2: 3
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959638700 Original CRISPR GGCCCACTGAACCACTCAGC AGG (reversed) Intronic
900867232 1:5277169-5277191 GGCCCACTGAAGCAATGACCAGG + Intergenic
904895111 1:33811302-33811324 GGTCCACAGCAGCACTCAGCTGG - Intronic
905871535 1:41407143-41407165 GGCCCACTGAACCTCAGGGCTGG - Intergenic
910481333 1:87661453-87661475 GACCCAATGAACCACTGAGAAGG - Intergenic
923842070 1:237683895-237683917 TGCCCACTGATCCATTTAGCAGG + Intronic
1065968653 10:30788513-30788535 GCCCCACTGAAACATTCACCGGG + Intergenic
1070946292 10:80394718-80394740 GGCCCACTGAGTCACTGTGCTGG - Intergenic
1076480104 10:130779310-130779332 AGCTCACTGAACCACACTGCAGG - Intergenic
1077442745 11:2576259-2576281 GGGACACTCAACCACTGAGCCGG - Intronic
1077462360 11:2716971-2716993 GGCCCACTGAACAGCTCCACAGG - Intronic
1078100207 11:8325951-8325973 GGGCCAGAGGACCACTCAGCTGG - Intergenic
1080718399 11:34825695-34825717 GGCCCATTGAATCAGGCAGCAGG - Intergenic
1081545909 11:44071393-44071415 GGGCCACTGAGCCAAGCAGCAGG - Intronic
1081838477 11:46177210-46177232 GGTCCTCAGAACCAGTCAGCCGG - Intergenic
1083482504 11:62958841-62958863 AGCCTGATGAACCACTCAGCAGG + Intronic
1085319231 11:75564012-75564034 GCCCCACTGAACCCAGCAGCAGG - Intronic
1087624480 11:100581366-100581388 AGACCCCTGAACCAGTCAGCAGG - Intergenic
1089124146 11:116164531-116164553 AGCCCTCTCAACCTCTCAGCGGG + Intergenic
1091110817 11:132964711-132964733 GGTCCTCTGATCCCCTCAGCAGG + Intronic
1091312723 11:134586050-134586072 GGCCCACTGGACATCTCATCTGG + Intergenic
1093075702 12:14756418-14756440 GCCCCACGGCCCCACTCAGCTGG - Intergenic
1107400608 13:40065378-40065400 GGCCGACTGTAAAACTCAGCTGG + Intergenic
1107730645 13:43344937-43344959 GCACCACAGAACCACTCAGGAGG + Intronic
1111981584 13:95021845-95021867 GCCCCACTAAAACCCTCAGCAGG + Intronic
1122010145 14:98739815-98739837 GGCGCATTGAATCAATCAGCTGG + Intergenic
1122956655 14:105074487-105074509 GGCCCCCTGAACCCCAGAGCTGG + Intergenic
1125007690 15:34836767-34836789 GCCCCACTTAACAACTCAGCAGG - Intergenic
1128699358 15:69793075-69793097 GGCCCAGGGCACCTCTCAGCAGG + Intergenic
1132334496 15:101037374-101037396 GGTGGACTGAACCACTGAGCTGG + Intronic
1138190462 16:55009815-55009837 GGCCCACTAGATTACTCAGCTGG - Intergenic
1139349710 16:66327461-66327483 TGCCCGCTGAACCACTCTGCGGG + Intergenic
1141589084 16:85055895-85055917 GGCCCACTCAAACTCTAAGCTGG + Intronic
1141613951 16:85199753-85199775 TGCCCACTCAGCCACACAGCAGG + Intergenic
1144222841 17:13115364-13115386 GGCCCACTGGACCGGTCATCGGG - Intergenic
1144497788 17:15759629-15759651 GTCCCAGTGAACAACTCACCAGG + Intergenic
1145161158 17:20574679-20574701 GTCCCAGTGAACAACTCACCAGG + Intergenic
1149889131 17:60370635-60370657 TGCCCACCCAACCACTCAGGAGG + Intronic
1151435131 17:74090602-74090624 GGCCCACTGGCCCACAGAGCTGG + Intergenic
1154346027 18:13544245-13544267 GGCCCACTGCAGCACTCTGACGG - Intronic
1157732792 18:50019317-50019339 GGCCGACTCACCCACTGAGCAGG - Intronic
1168123873 19:54272113-54272135 GGCCCCCAAAACCACTCAGGAGG - Intronic
1168178486 19:54643422-54643444 GGCCCCCAAAACCACTCAGGAGG + Intronic
926953671 2:18271527-18271549 TGACCAATGAACCAATCAGCAGG - Intronic
933092208 2:78135518-78135540 GGGCCACTGTAGCTCTCAGCTGG + Intergenic
936950674 2:117974600-117974622 GGCCCTGTGAACCTCCCAGCAGG + Intronic
948138607 2:235656557-235656579 TTCCCACCGAACCACTCACCGGG + Intronic
1174183147 20:48687500-48687522 GGCCCACACAACCTCTCACCTGG + Intronic
1179512309 21:41881097-41881119 GGCCCACAGAACCAGTCATCTGG - Intergenic
1181752868 22:25001795-25001817 GGCCAACAGGACCACACAGCAGG - Intronic
1183832228 22:40424376-40424398 GGCCCACTGAAACCCAAAGCTGG + Exonic
1184638202 22:45852792-45852814 GGCCTCCTGGACCACTCAGGTGG - Intergenic
951746871 3:25987991-25988013 AGCCCTCTGATCCACTCTGCTGG - Intergenic
952752159 3:36833401-36833423 GACACGCTCAACCACTCAGCTGG - Exonic
954320410 3:49828871-49828893 AGCCCACTGATCCTGTCAGCAGG - Exonic
955693755 3:61615438-61615460 GGCCCAGAGCACCACTCCGCTGG - Intronic
959638700 3:108606210-108606232 GGCCCACTGAACCACTCAGCAGG - Intronic
961140095 3:124548514-124548536 GCACCACTGAGCCATTCAGCAGG + Intronic
961468756 3:127098119-127098141 AGCCCTCTAGACCACTCAGCTGG - Intergenic
969316311 4:6383273-6383295 GCCCCACTGACCCACAGAGCAGG + Intronic
987391879 5:17384290-17384312 TGCCCACTGAGCCACTATGCAGG + Intergenic
988796301 5:34656323-34656345 CGCCCACTGACCCCCGCAGCGGG + Intronic
988989417 5:36654892-36654914 TGTCCCCTGCACCACTCAGCTGG - Intronic
989242772 5:39219594-39219616 GGCTCACTCAACCACTGACCGGG - Intronic
999564124 5:152838492-152838514 GTCCCACGGCAGCACTCAGCAGG + Intergenic
999633482 5:153596433-153596455 GGCTCACTGATCCCCACAGCAGG + Intronic
1006637015 6:35468310-35468332 GGCCCACCCAACCGCTCTGCGGG + Intergenic
1018746559 6:166766919-166766941 GGCCCACAGGGCCACGCAGCTGG - Intronic
1019421391 7:952907-952929 GGACCACTGAAGGACCCAGCAGG + Intronic
1019438102 7:1032099-1032121 GGCCCACTGACCACCTGAGCAGG - Intronic
1019630411 7:2046037-2046059 TGGCCACTGCAGCACTCAGCTGG - Intronic
1019721859 7:2577167-2577189 GGCCCAGGGAAGCACTGAGCTGG - Intronic
1022471375 7:30683508-30683530 AGCCCAATGCCCCACTCAGCTGG - Intronic
1032304250 7:130717737-130717759 GGGCCACTGTAACACACAGCAGG + Intergenic
1032402430 7:131633181-131633203 GGCCCACTGCTACATTCAGCAGG - Intergenic
1034393492 7:150802970-150802992 TGCCCAATAATCCACTCAGCTGG - Intronic
1034672678 7:152870217-152870239 GGACCCCTGAACCATGCAGCAGG - Intergenic
1035043546 7:155948641-155948663 GGCCCACTGACCCTGTGAGCAGG + Intergenic
1037581169 8:20246827-20246849 GACCCACTGACCCACTCGGATGG - Exonic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039220945 8:35329950-35329972 CTGCCACTGAAGCACTCAGCAGG - Intronic
1039375089 8:37024900-37024922 TCCCCACTGAGCCCCTCAGCTGG + Intergenic
1045305325 8:100952422-100952444 GGCCCACTCTTCCTCTCAGCCGG + Intronic
1047076000 8:121403704-121403726 GGCCCACTTAACTGCTCAGCTGG - Intergenic
1048268664 8:133010539-133010561 GCCCCACTGAACATCTCTGCAGG + Intronic
1057034187 9:91799820-91799842 GGCCCACTGTACCCCTCAGCAGG + Intronic
1059650674 9:116313236-116313258 GGCACAGGGAACCTCTCAGCAGG - Intronic
1187192353 X:17046809-17046831 GGACCACTGAACCTCTCATTTGG - Intronic
1189309629 X:40010271-40010293 GGCGCAATGAGCTACTCAGCGGG - Intergenic
1195105970 X:101601461-101601483 GGCCCTCTGCAGCACTCTGCTGG - Intergenic
1195106913 X:101612306-101612328 GGCCCTCTGCAGCACTCTGCTGG + Intergenic
1198226749 X:134652432-134652454 GGCCAGCTGCACCACTCACCTGG - Intronic
1200779546 Y:7201871-7201893 GGACCAGTGGACCAGTCAGCAGG + Intergenic
1200953941 Y:8927140-8927162 GGCAGAGTGAATCACTCAGCTGG + Intergenic
1202051962 Y:20790896-20790918 GGACCAGTGGACCAGTCAGCAGG - Intergenic