ID: 959642999

View in Genome Browser
Species Human (GRCh38)
Location 3:108662906-108662928
Sequence CTTGGATGGCTGGTGTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959642999_959643005 22 Left 959642999 3:108662906-108662928 CCATAAGACACCAGCCATCCAAG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195
959642999_959643004 21 Left 959642999 3:108662906-108662928 CCATAAGACACCAGCCATCCAAG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 959643004 3:108662950-108662972 GCAGTTTCTAGAATGCTGATAGG 0: 1
1: 0
2: 1
3: 30
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959642999 Original CRISPR CTTGGATGGCTGGTGTCTTA TGG (reversed) Intronic