ID: 959643000 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:108662916-108662938 |
| Sequence | AACTAGACTTCTTGGATGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 123 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 110} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959643000_959643005 | 12 | Left | 959643000 | 3:108662916-108662938 | CCAGCCATCCAAGAAGTCTAGTT | 0: 1 1: 0 2: 0 3: 12 4: 110 |
||
| Right | 959643005 | 3:108662951-108662973 | CAGTTTCTAGAATGCTGATAGGG | 0: 1 1: 0 2: 2 3: 9 4: 195 |
||||
| 959643000_959643004 | 11 | Left | 959643000 | 3:108662916-108662938 | CCAGCCATCCAAGAAGTCTAGTT | 0: 1 1: 0 2: 0 3: 12 4: 110 |
||
| Right | 959643004 | 3:108662950-108662972 | GCAGTTTCTAGAATGCTGATAGG | 0: 1 1: 0 2: 1 3: 30 4: 337 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959643000 | Original CRISPR | AACTAGACTTCTTGGATGGC TGG (reversed) | Intronic | ||