ID: 959643000

View in Genome Browser
Species Human (GRCh38)
Location 3:108662916-108662938
Sequence AACTAGACTTCTTGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959643000_959643004 11 Left 959643000 3:108662916-108662938 CCAGCCATCCAAGAAGTCTAGTT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 959643004 3:108662950-108662972 GCAGTTTCTAGAATGCTGATAGG 0: 1
1: 0
2: 1
3: 30
4: 337
959643000_959643005 12 Left 959643000 3:108662916-108662938 CCAGCCATCCAAGAAGTCTAGTT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959643000 Original CRISPR AACTAGACTTCTTGGATGGC TGG (reversed) Intronic