ID: 959643001

View in Genome Browser
Species Human (GRCh38)
Location 3:108662920-108662942
Sequence TTTAAACTAGACTTCTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959643001_959643005 8 Left 959643001 3:108662920-108662942 CCATCCAAGAAGTCTAGTTTAAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195
959643001_959643004 7 Left 959643001 3:108662920-108662942 CCATCCAAGAAGTCTAGTTTAAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 959643004 3:108662950-108662972 GCAGTTTCTAGAATGCTGATAGG 0: 1
1: 0
2: 1
3: 30
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959643001 Original CRISPR TTTAAACTAGACTTCTTGGA TGG (reversed) Intronic