ID: 959643002

View in Genome Browser
Species Human (GRCh38)
Location 3:108662924-108662946
Sequence GGATTTTAAACTAGACTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959643002_959643004 3 Left 959643002 3:108662924-108662946 CCAAGAAGTCTAGTTTAAAATCC 0: 1
1: 0
2: 2
3: 19
4: 256
Right 959643004 3:108662950-108662972 GCAGTTTCTAGAATGCTGATAGG 0: 1
1: 0
2: 1
3: 30
4: 337
959643002_959643005 4 Left 959643002 3:108662924-108662946 CCAAGAAGTCTAGTTTAAAATCC 0: 1
1: 0
2: 2
3: 19
4: 256
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959643002 Original CRISPR GGATTTTAAACTAGACTTCT TGG (reversed) Intronic