ID: 959643005

View in Genome Browser
Species Human (GRCh38)
Location 3:108662951-108662973
Sequence CAGTTTCTAGAATGCTGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959642999_959643005 22 Left 959642999 3:108662906-108662928 CCATAAGACACCAGCCATCCAAG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195
959643002_959643005 4 Left 959643002 3:108662924-108662946 CCAAGAAGTCTAGTTTAAAATCC 0: 1
1: 0
2: 2
3: 19
4: 256
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195
959643001_959643005 8 Left 959643001 3:108662920-108662942 CCATCCAAGAAGTCTAGTTTAAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195
959643000_959643005 12 Left 959643000 3:108662916-108662938 CCAGCCATCCAAGAAGTCTAGTT 0: 1
1: 0
2: 0
3: 12
4: 110
Right 959643005 3:108662951-108662973 CAGTTTCTAGAATGCTGATAGGG 0: 1
1: 0
2: 2
3: 9
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959643005 Original CRISPR CAGTTTCTAGAATGCTGATA GGG Intronic