ID: 959645522

View in Genome Browser
Species Human (GRCh38)
Location 3:108695445-108695467
Sequence CTCAGCAGGGTGGAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959645522_959645528 11 Left 959645522 3:108695445-108695467 CCAGAACACTCCACCCTGCTGAG 0: 1
1: 0
2: 0
3: 12
4: 248
Right 959645528 3:108695479-108695501 GGACCAGAAAGCTCTTAAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 136
959645522_959645525 -10 Left 959645522 3:108695445-108695467 CCAGAACACTCCACCCTGCTGAG 0: 1
1: 0
2: 0
3: 12
4: 248
Right 959645525 3:108695458-108695480 CCCTGCTGAGAAATCCAGTGAGG 0: 1
1: 0
2: 0
3: 28
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959645522 Original CRISPR CTCAGCAGGGTGGAGTGTTC TGG (reversed) Intergenic
900495239 1:2973155-2973177 GTCAGCACGGTGGAGGGCTCAGG + Intergenic
900921677 1:5676065-5676087 CTCTGCAGGGCAGAGTATTCAGG - Intergenic
903177889 1:21591398-21591420 CTGAGCAGGGGGCAGAGTTCAGG + Intergenic
903335235 1:22620170-22620192 CTCAGCAGGAGGGAGTGACCAGG - Intergenic
903670450 1:25032201-25032223 CTCAGCGGCGTGGAGTGAGCGGG - Intergenic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
906504433 1:46367802-46367824 CTCACCAGGGTGGAGTGCCGTGG + Intergenic
908085023 1:60622710-60622732 CTCAGGAGGCTGGAGTGGGCTGG + Intergenic
909780116 1:79534271-79534293 TTAAGCAGGGTTGAGTTTTCTGG + Intergenic
910225420 1:84931171-84931193 CACAGCAGGGTGGATTGGTTTGG - Intronic
911063029 1:93764182-93764204 GGCAGCAGCGTGGGGTGTTCTGG - Intronic
913371754 1:118107319-118107341 CTGAGGTGGGTGGAGTGCTCTGG - Intronic
915391324 1:155546716-155546738 GTCACCAGGGTGGAGTGTAGTGG - Intronic
915534108 1:156524263-156524285 CACAGCAGAGTGGAGTGTTGGGG + Intergenic
915913259 1:159927346-159927368 CACAGCAGAGTGGCCTGTTCGGG + Exonic
916488512 1:165280370-165280392 CTCATCAGGGTGGGGTGCTTTGG - Intronic
917387365 1:174491707-174491729 CACTGCAGGATGGAGTGCTCTGG - Intronic
919363010 1:196619080-196619102 CTCTTCAGGCTGGAGTGATCTGG - Intergenic
920508799 1:206535662-206535684 CTCAGCATGGTGATGTTTTCAGG + Intronic
920895945 1:210049578-210049600 GTCAGCAGGGTGGGGTGTAAGGG - Intronic
922909185 1:229201137-229201159 CTAGGCAGGTTGGAGTGTGCAGG + Intergenic
922986372 1:229869085-229869107 CTCAGGAGGATGTAGTGTTGAGG + Intergenic
1063713626 10:8505686-8505708 TTCAGCAGAGGGGACTGTTCAGG + Intergenic
1064199079 10:13269558-13269580 CTCACCAGGCTGGAGTGTAGTGG - Intergenic
1065936735 10:30527185-30527207 GTCAGCAGGCTGGAGTGCTGTGG + Intergenic
1065952843 10:30667612-30667634 CTGAGCATGGTGGTGTGTGCAGG - Intergenic
1066096011 10:32072550-32072572 CTAAGCTGGGTCGTGTGTTCAGG + Intergenic
1066457612 10:35585548-35585570 CGCAGCAGGGTGCAGTATCCGGG - Intergenic
1067719962 10:48720893-48720915 CTCAGCATGGTGTAGATTTCAGG + Intronic
1069623504 10:69852600-69852622 CTCAGCAGGGTGGGGTGACTGGG + Intronic
1069861616 10:71475262-71475284 CCCAGCAGGCTGGAGAGGTCAGG - Intronic
1071787353 10:88916565-88916587 CCCAGCAGGGGGGTGTGTCCAGG - Intronic
1072281632 10:93870939-93870961 CCCAACAGAGTGCAGTGTTCAGG + Intergenic
1076528250 10:131126333-131126355 CTCAGCATGGTGGACGGTCCAGG - Intronic
1080324764 11:31057850-31057872 ATCACCAGGGAGGAGTGTTCAGG + Intronic
1081970506 11:47195087-47195109 GTCAGAAGGGTGGAGTGGGCAGG + Intergenic
1083893792 11:65610305-65610327 CTCAGCTTGATGAAGTGTTCAGG - Intronic
1084670087 11:70601257-70601279 GTCACCAGGCTGGAGTGTACTGG + Intronic
1086880990 11:92153029-92153051 CGAACCAGGGTAGAGTGTTCAGG - Intergenic
1086953076 11:92910364-92910386 CTCAGCAGGATGGAGTCCTTAGG - Intergenic
1087719055 11:101641112-101641134 CTCATCAGGGTGCTGTATTCAGG + Intronic
1088882326 11:113981916-113981938 CCCAGCAGGCTGGAGTGTAATGG - Intronic
1090294636 11:125576293-125576315 CTTGGAATGGTGGAGTGTTCTGG + Exonic
1091500505 12:1012510-1012532 GTCAACAGGCTGGAGTGTTGTGG + Intronic
1092304582 12:7285784-7285806 CTCATCAGTGTGCTGTGTTCAGG + Intergenic
1094116936 12:26926468-26926490 CGAAGCAGGCTGAAGTGTTCAGG - Intronic
1096019884 12:48315213-48315235 GTCAGCAGGCTGGAGTGTAGTGG + Intergenic
1096192793 12:49631285-49631307 CAGAGCAGGGTGGAGGGTTGGGG + Intronic
1096302222 12:50440184-50440206 CTCAGCACTTTGGAGTGCTCAGG + Intronic
1098214287 12:68199407-68199429 CTCAGCAGGGTTGAGAGACCAGG - Intergenic
1098769041 12:74529553-74529575 GTCAGCAGGCTGGAGTGCTGTGG + Intergenic
1100977245 12:100135306-100135328 CTCTGCAGGCTGGAGTGTAGTGG + Intronic
1101158552 12:101951123-101951145 CTCAGCAGGGTGGAGCTTATAGG - Intronic
1101920036 12:108924970-108924992 GTCAGCAGGAAGGAGTGTTAAGG - Intronic
1102306040 12:111805362-111805384 ATCACCAGGCTGGAGTGTACTGG + Intronic
1104638814 12:130454395-130454417 GTCTGCAGGGAGGAGTGTCCTGG + Intronic
1104736407 12:131138289-131138311 GTCAGCAGGATGGGGTGTGCAGG + Intronic
1104971931 12:132534685-132534707 CTGGGCTGGGTGGAGGGTTCAGG + Intronic
1105226402 13:18438314-18438336 CTCACCAGGGTGGAGTGCAGTGG + Intergenic
1105893337 13:24697935-24697957 CTCAGGAAGCTGGAGTGTTTGGG - Intronic
1107568944 13:41635835-41635857 CGCAGGAGGGTGGAGATTTCAGG + Intronic
1110620137 13:77585777-77585799 CTCAGCAAGGTGGAGTGGAAGGG - Intronic
1114249067 14:20942242-20942264 CTCACCAGGCTGGAGTGTAGTGG + Intergenic
1115337030 14:32252311-32252333 CTCAGTAAGGTGAGGTGTTCTGG + Intergenic
1117384346 14:55195633-55195655 CACAGCAGGCTGAAGTGCTCTGG - Intergenic
1117879983 14:60303813-60303835 TTCACCTGAGTGGAGTGTTCTGG + Intergenic
1118820627 14:69343224-69343246 CTCTGAGGGGTGGAGTGTTCTGG - Intronic
1120055753 14:79922170-79922192 CTCAGAAGGGTGGAGAGTTGAGG - Intergenic
1121120259 14:91371917-91371939 CCCAGCAGGCTGGGGTGGTCTGG - Intronic
1121384941 14:93511485-93511507 GTCACCAGGCTGGAGTGTTGTGG + Intronic
1122290894 14:100679929-100679951 CTCAGCAGGAAGGAATGTGCAGG - Intergenic
1123951948 15:25287815-25287837 ATCAGCAAGGTGGAGTGGTTGGG + Intergenic
1124210681 15:27762609-27762631 ATGTGCAGGGTGGAGTGTTCGGG - Intronic
1125545208 15:40498289-40498311 CTCAGCATAGGGGAGTGTCCAGG - Intergenic
1126678419 15:51181762-51181784 TTCAGCAGGTTGGAGAGTGCAGG + Intergenic
1126763825 15:51993907-51993929 CTGGGCATGGTGGTGTGTTCCGG - Intronic
1128818317 15:70630130-70630152 CTCTGCAGGGTGCTGTGCTCTGG - Intergenic
1129120663 15:73394499-73394521 CTCAGCTGGAAGGAGTGGTCAGG - Intergenic
1129249553 15:74301360-74301382 CATGGCAGGGTGGAGAGTTCTGG - Intronic
1129524390 15:76204596-76204618 TTCAGCAGGGTAGAGTGTGGGGG + Exonic
1129674387 15:77624696-77624718 CACAGCAGGGTGGGGTGCACTGG - Intronic
1132014069 15:98300428-98300450 CTGCACAGGGAGGAGTGTTCTGG + Intergenic
1132502640 16:291402-291424 CTGCGCAGGGTGGGTTGTTCGGG - Intronic
1134257299 16:12622789-12622811 GTCAGGAGGCTGGAGTGTACTGG + Intergenic
1134680399 16:16120843-16120865 CTCAGCTGGGCTGAGTGTGCTGG + Intronic
1135510438 16:23078270-23078292 CTCACCAGGCTGGAGTGTGGTGG - Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136907954 16:34119655-34119677 CTCTGCAGGGCAGAGTATTCAGG - Intergenic
1137520738 16:49193410-49193432 CTCAGCAGTGTGGAGACTTTGGG + Intergenic
1140191216 16:72818640-72818662 CTCAGCAGGGGGCGGTCTTCAGG + Intronic
1140286920 16:73612096-73612118 CTGAGCATGGTGGAGAGTTGTGG + Intergenic
1143470894 17:7174442-7174464 AGCAGCAGGCTGGAGTGATCTGG + Exonic
1143501108 17:7339568-7339590 CTCCGCAGGCTGGAGTGTGGTGG - Intronic
1143505107 17:7359689-7359711 GTGAGCAGTGTGGAGTTTTCAGG - Intergenic
1144121832 17:12162365-12162387 CTCACCAGGGTGGAGTGCAGTGG + Intergenic
1144366425 17:14549251-14549273 CTCAGAAGAGAGGAGTGTGCTGG - Intergenic
1144861519 17:18306397-18306419 CTCACCAGGCTGGAGTGTGGTGG + Intronic
1144958606 17:19032476-19032498 CTCACAAGGCTGGGGTGTTCAGG + Intronic
1144976553 17:19142048-19142070 CTCACAAGGCTGGGGTGTTCAGG - Intronic
1146211076 17:30944226-30944248 CTCAGCAACGTGGATTGATCTGG + Intronic
1146460538 17:33042750-33042772 CACAGCAGGGTGGAGTCCACAGG + Intronic
1147659796 17:42111462-42111484 CCCAGCATGGTGAAGAGTTCAGG - Exonic
1148249388 17:46062396-46062418 CTCACCAGGCTGGAGTGCTGTGG + Intronic
1153305445 18:3626552-3626574 CCCAGCAGGGTGGAGTGCAGTGG - Intronic
1153539713 18:6140502-6140524 CTCAGCAGGGCTGAGGGTGCAGG - Intronic
1154526983 18:15301165-15301187 CTCACCAGGGTGGAGTGCAGTGG - Intergenic
1155544437 18:26901050-26901072 AGCAGCAGGGTGGATTGTGCTGG - Intergenic
1157038538 18:44008355-44008377 CTCTGCAGGCTGGAGTGTAGTGG + Intergenic
1159727058 18:71974621-71974643 GTCACCAGGCTGGAGTGTGCTGG + Intergenic
1160752950 19:743300-743322 CTGAGGAGGGTGGAGTGATGGGG - Intronic
1161286214 19:3469714-3469736 CTCAGCAGGGTGGAGGATCATGG + Intergenic
1161757789 19:6147059-6147081 GTCAGCAGGCTGGAGTGCACTGG - Intronic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1161923859 19:7286528-7286550 CTGAGCATGGTGGTGTGTACCGG - Intronic
1162330451 19:10025706-10025728 CTCAGCAGGCTGGAGTGCAGTGG - Intergenic
1164061553 19:21679643-21679665 GTCAGCAGGGTGTGGTTTTCAGG - Intergenic
1164127296 19:22330072-22330094 CTCAGCTGTGTGCAGTGCTCAGG - Intergenic
1164164164 19:22653597-22653619 CTCAGGAGTGTGGAAAGTTCAGG - Intronic
1164646543 19:29862545-29862567 CTCTGCAGGGTGAAGTCTCCAGG - Intergenic
1165013754 19:32866328-32866350 CTCAGCAGGAGGGAGGATTCTGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166643278 19:44512554-44512576 TTCAGCAGGAAGGAGTGTTGTGG + Intronic
1167408938 19:49333708-49333730 CTCAGCAGGCAGGAGGGATCTGG + Intergenic
1167920367 19:52778524-52778546 CTGGGCAGGCTGGATTGTTCAGG - Intronic
926227404 2:10978202-10978224 CTCAGCCGGGTGCAGAGTTCTGG - Intergenic
928170097 2:28998036-28998058 CCCTGCGGGGTGGAGTGCTCAGG + Intronic
928756745 2:34535327-34535349 GTCAGTAGGGTGGAGAATTCAGG + Intergenic
928964365 2:36962649-36962671 CTGAGCATGGTGGTGTGTGCTGG - Intronic
929145316 2:38702423-38702445 CACAGCAGGGTGGGGTGTGAGGG - Intronic
929147926 2:38722653-38722675 CTCAGCAATGCTGAGTGTTCAGG - Intronic
930023830 2:47017663-47017685 CTCAGCATAGTGGACTGTGCGGG + Intronic
934987129 2:98895619-98895641 CTTAGCATGGTGTAATGTTCTGG - Intronic
937458551 2:122065915-122065937 CTCAGCAGGGTGGATGAGTCTGG + Intergenic
937496643 2:122427254-122427276 CTCAGCAGGGTATAGAGTTATGG - Intergenic
940337965 2:152548135-152548157 GTCAGGAGGGTGGTGTGCTCTGG + Intronic
942583940 2:177453736-177453758 CTCAGCAGGCTGGAGTGCAGTGG + Intronic
942632089 2:177961346-177961368 CTCAGCAGGCTGGGGTGTCAGGG - Intronic
945972263 2:216242456-216242478 CTCAGCAGGTGGAAGTTTTCAGG - Intergenic
946372318 2:219288303-219288325 CTATACAGGGTGGAGGGTTCTGG + Intergenic
947518602 2:230828030-230828052 CCCAGCAGGGCGGAACGTTCTGG - Intergenic
948776821 2:240293505-240293527 CTAAGCATGGTGGGGAGTTCTGG + Intergenic
949009589 2:241670930-241670952 CTGAGCAGGGTGGGGCGTCCTGG + Intronic
1168833017 20:857667-857689 GTCTGCAGGGAAGAGTGTTCTGG + Intergenic
1169306891 20:4499727-4499749 CCCATCAGTGTGGTGTGTTCAGG - Intergenic
1169845432 20:9986479-9986501 GTCAGGTGGGTGCAGTGTTCTGG - Intronic
1170424429 20:16224323-16224345 GTCACCAGGGTGGAGTGTAGTGG - Intergenic
1170688463 20:18589720-18589742 ATTAGCAGGATGGAGAGTTCAGG - Intronic
1171815046 20:29778501-29778523 CTCTGCAGGGCAGAGTATTCAGG + Intergenic
1171903390 20:30878220-30878242 CTCTGCAGGGCAGAGTATTCAGG - Intergenic
1172669376 20:36624199-36624221 CTCAGCAGGAAGGAGGGGTCAGG + Intronic
1172821991 20:37744638-37744660 CTCAGCAGGGAAGAGTGCTGTGG + Intronic
1173727907 20:45309574-45309596 CTCAGAATGGTGGTGTGCTCTGG - Exonic
1175292430 20:57885138-57885160 CTCATCCTGGTGGAGAGTTCTGG - Intergenic
1175461573 20:59155625-59155647 CGCAGCAGGGAGGAGTGCTGGGG + Intergenic
1176770454 21:13067340-13067362 CTCACCAGGGTGGAGTGCAGTGG + Intergenic
1179110867 21:38443996-38444018 CTCAGAGTGGAGGAGTGTTCTGG + Intronic
1179299223 21:40091388-40091410 CCCAGCAGGGTCCAGTGTCCTGG + Intronic
1179312949 21:40212940-40212962 CTCAGCAGTGTGAAGGGTTGAGG + Intronic
1180318481 22:11299053-11299075 CTCTGCAGGGCAGAGTATTCAGG + Intergenic
1181781894 22:25199788-25199810 CTCAGCAGGCTGGGATGTGCTGG + Intergenic
1183386404 22:37518009-37518031 GTGAGCAGCGTGAAGTGTTCGGG + Exonic
1183749647 22:39712588-39712610 CTCAGCTGGGGAGAGTCTTCAGG - Intergenic
1184688731 22:46107996-46108018 CACAGCAGGGTTGGGTGTGCAGG + Intronic
1184754907 22:46510296-46510318 CTCAGGAAGGGGGTGTGTTCTGG - Intronic
1184934383 22:47709651-47709673 CTAAGCTGGGTGGATTGTTTGGG + Intergenic
1184997442 22:48219039-48219061 CCCAGCAGGGTTGAGTCTTGAGG + Intergenic
1185011418 22:48316715-48316737 CTCAGCAGAGTGGAGGGCTGTGG - Intergenic
950161742 3:10765583-10765605 CTCAGCTGGGAGGTGGGTTCAGG - Intergenic
950400163 3:12763601-12763623 CTCAGCAGGCATGGGTGTTCTGG + Intronic
951254264 3:20431027-20431049 CTCAGCAGTGTGCTGTATTCAGG - Intergenic
952852578 3:37741192-37741214 CTCAGCAGGGTGGCTGGTGCTGG - Intronic
953374037 3:42413604-42413626 CAGGGCAGGGTGGAGTGTGCTGG + Intergenic
953501394 3:43438402-43438424 GTCAGCAGGCTGGAGTGTGGTGG - Intronic
954167247 3:48769815-48769837 CTCAGCAGGCTGGAGTGTAGTGG + Intronic
955379099 3:58422400-58422422 CTCAGCAGGCTGGAGCAGTCCGG - Intronic
955923904 3:63987041-63987063 CTCAGCAGTATGGAATGGTCAGG + Intronic
956182407 3:66529714-66529736 GTCAGCAGGGTGGAGTGCAGTGG - Intergenic
956867686 3:73385627-73385649 CTCAGCAGGGCAGAGTGTCAGGG + Intronic
957055807 3:75442110-75442132 CCCAGCAGGTTGGAGTGCGCTGG + Intergenic
957503245 3:81085196-81085218 CTCAGCAGGATGGCATGTTTAGG - Intergenic
959645522 3:108695445-108695467 CTCAGCAGGGTGGAGTGTTCTGG - Intergenic
960837353 3:121920333-121920355 GTCAGCAGGCTGGAGTGTGGTGG + Intronic
961150147 3:124631116-124631138 ACCAGGAGGGTGGGGTGTTCTGG - Intronic
961741522 3:129036100-129036122 CTGGGGAGGGTGGAGTGTTGTGG + Intronic
962564573 3:136644759-136644781 GTCACCAGGCTGGAGTGTGCTGG + Intronic
963150602 3:142042329-142042351 GTCACCAGGCTGGAGTGTTGTGG + Intronic
964320023 3:155486117-155486139 CTCAGCATGGTGCTTTGTTCTGG - Intronic
964639883 3:158897875-158897897 CTCACCAGGCTGGAGTGCACTGG + Intergenic
965775753 3:172229319-172229341 GTAAGCAGGGTTGAGTGTTATGG - Intronic
968180327 3:196590517-196590539 CTCAGAAGGGTGGATTGCGCTGG - Intergenic
969627979 4:8317310-8317332 GTCAGCAGGGTGGGGTGATGGGG + Intergenic
969815823 4:9686734-9686756 CTCTGCAAGGTGCAGTGATCGGG + Intergenic
970428616 4:15967423-15967445 CTCAGCAGGCTGGAGTGCAGTGG + Intronic
975378898 4:73675844-73675866 CTCAGCAGGGTAGTGGGTTTGGG + Intergenic
980009624 4:127580937-127580959 GTCAGCTGGGTGGAGTGCACTGG + Intergenic
983787334 4:171749861-171749883 CTCACCAGGGTGGAGTGCAGTGG + Intergenic
983969257 4:173851104-173851126 CTCAGGAGGGTGGAGCCCTCAGG + Intergenic
986044943 5:4027676-4027698 CGTCTCAGGGTGGAGTGTTCAGG + Intergenic
987214795 5:15722881-15722903 GTCAGCAGGCTGGAGTGTAGTGG - Intronic
990278368 5:54224114-54224136 CTCAGCAGAGTGGAGTGAGGAGG + Intronic
992133340 5:73717913-73717935 GTCACCAGGCTGGAGTGTGCTGG + Intronic
994469445 5:100184019-100184041 TTCAGCTGGGTGGTTTGTTCTGG - Intergenic
998059331 5:139107025-139107047 CTCTGCAGGGCTGAGTGATCAGG - Intronic
998253002 5:140564997-140565019 CTCAACAGTGTGGAGTGGTGTGG + Exonic
999201568 5:149820425-149820447 CTCCTCAGGGTGGAGGGTCCGGG + Exonic
1000225426 5:159256491-159256513 CTGAGCAGGGTTGGGAGTTCAGG - Intergenic
1000803359 5:165757316-165757338 CTCACCAGGCTGGAGTGCTGTGG + Intergenic
1001978858 5:176023674-176023696 ATCACCAGGCTGGAGTGTACTGG - Intronic
1002133991 5:177097133-177097155 CTCAGCCTAGTGGAGTGTCCTGG + Intronic
1002238557 5:177820088-177820110 GTCACCAGGCTGGAGTGTACTGG + Intergenic
1002571439 5:180141747-180141769 CTCACCAGGCTGGAGTGTAGTGG + Intronic
1002649201 5:180679382-180679404 CTCAACAGGGTGGGGTGGTGAGG + Intergenic
1007251975 6:40501897-40501919 ATCAACAAGGTGGAATGTTCAGG - Intronic
1007432924 6:41786825-41786847 GGCAGCAGCGAGGAGTGTTCGGG - Exonic
1007975591 6:46098029-46098051 CTCAGCATGGAGGAGTGTGCAGG + Intergenic
1008762068 6:54863045-54863067 CTCAGCAGTGAGGTGTGTTGTGG - Intronic
1011657048 6:89561505-89561527 CTCAGAAGGAGGAAGTGTTCTGG + Intronic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1017123591 6:151045922-151045944 CTCCTCAGTGTGGTGTGTTCAGG + Intronic
1017178740 6:151529615-151529637 GTCAGCAGGGTGGAGTGCAGTGG - Intronic
1018882373 6:167897684-167897706 GTCAGCAGGCTGGAGTGCTGTGG + Intronic
1019877262 7:3824965-3824987 GGCAGCGGGGTGGAGAGTTCAGG - Intronic
1024230103 7:47357448-47357470 TTCAGCTGGGAGGAGTGTTGGGG - Intronic
1025119037 7:56284073-56284095 CTCACCAGGCTGGAGTGTAGTGG - Intergenic
1025622030 7:63182135-63182157 CTCAGAAGGGTGGGAGGTTCGGG - Intergenic
1025866604 7:65388202-65388224 CTCAGGAATGTGGAGAGTTCAGG - Intronic
1028162786 7:87505001-87505023 GTCACCAGGGTGGAGTGTAGTGG + Intronic
1032002898 7:128276758-128276780 CTCAGAAGGGAGGAGGGTTGGGG + Intergenic
1033252050 7:139768819-139768841 CTCGGCATTCTGGAGTGTTCTGG + Intronic
1033810452 7:145005334-145005356 CTTGGAATGGTGGAGTGTTCTGG + Intergenic
1034698637 7:153077404-153077426 CTCAGCAGGGTGGACTTTTTTGG - Intergenic
1037196141 8:16192938-16192960 CTCACCAGGGTGGAGTGCAGTGG + Intronic
1037248367 8:16863254-16863276 GTCACCAGGCTGGAGTGTTGTGG - Intergenic
1038854304 8:31314346-31314368 TTTAGCAGGGTGGTGAGTTCTGG + Intergenic
1040305593 8:46210163-46210185 CTCCGCAGGGTGGCGTGGGCTGG + Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1043989118 8:86730963-86730985 CTCAGAAGGGATGAGAGTTCTGG + Intronic
1046338673 8:112824217-112824239 CTCATCAGGGTGCTGTATTCAGG - Intronic
1046606980 8:116382294-116382316 ATCAGCAGGGTGCACTGTTATGG - Intergenic
1049444257 8:142622779-142622801 CTCAGCAGTGGGGAGTGTGATGG + Intergenic
1050047328 9:1560643-1560665 CCCATCAGTGTGGGGTGTTCAGG + Intergenic
1050702226 9:8353470-8353492 CCCAGGAGGCTGGAGTGTGCTGG + Intronic
1056786540 9:89596697-89596719 CACAACAGTGTGGAGTGTACAGG + Intergenic
1058234199 9:102468683-102468705 TACAGCAGGGTGGAGGGTTGAGG + Intergenic
1061422009 9:130477720-130477742 TTCAGGAGGCTGGAGTGATCAGG + Intronic
1062045435 9:134422531-134422553 CCCAGGAGGGGGGAGTGTCCCGG - Intronic
1203366714 Un_KI270442v1:264813-264835 CTCCGCAGGGCAGAGTATTCAGG + Intergenic
1185709379 X:2290803-2290825 CTCCTCAGTGTGGAGGGTTCAGG + Intronic
1187009254 X:15263681-15263703 CTCAGGAGGGGTGAGTTTTCTGG - Intronic
1187549621 X:20288938-20288960 GTCAGCAGGGTGGTTTCTTCTGG + Intergenic
1188380307 X:29483729-29483751 CTCAGCAGGCTGGAGTGCAGTGG + Intronic
1189847051 X:45147813-45147835 ATCAGCTGGGTGGGGAGTTCTGG + Intergenic
1190278520 X:48914350-48914372 CTGAGAAGGATGGAGTCTTCTGG + Intronic
1190523244 X:51300858-51300880 GTCACCAGGCTGGAGTGTACTGG - Intergenic
1190720250 X:53142021-53142043 GTCATCAGGGCTGAGTGTTCTGG - Intergenic
1192804317 X:74495954-74495976 TTCAGGAGGGGGCAGTGTTCAGG + Intronic
1194916059 X:99710483-99710505 CACAGCGGGGTGGTGTGTTATGG - Intergenic
1195524332 X:105869125-105869147 GACAGCAGGGTGGAATGTTGAGG + Intronic
1201071970 Y:10155412-10155434 CTCTGCAGGGCAGAGTATTCAGG - Intergenic
1201522486 Y:14891260-14891282 CTCAGCACTTTGGAGTGTTGAGG + Intergenic