ID: 959648854

View in Genome Browser
Species Human (GRCh38)
Location 3:108732254-108732276
Sequence CCTGCTACTAGGTGGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959648848_959648854 9 Left 959648848 3:108732222-108732244 CCTCCATCATGAAAGGTGTCCGA No data
Right 959648854 3:108732254-108732276 CCTGCTACTAGGTGGTCAGCTGG No data
959648850_959648854 -10 Left 959648850 3:108732241-108732263 CCGATATAAACAACCTGCTACTA No data
Right 959648854 3:108732254-108732276 CCTGCTACTAGGTGGTCAGCTGG No data
959648849_959648854 6 Left 959648849 3:108732225-108732247 CCATCATGAAAGGTGTCCGATAT No data
Right 959648854 3:108732254-108732276 CCTGCTACTAGGTGGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959648854 Original CRISPR CCTGCTACTAGGTGGTCAGC TGG Intergenic
No off target data available for this crispr