ID: 959649247

View in Genome Browser
Species Human (GRCh38)
Location 3:108735844-108735866
Sequence CTGTCCCTGCAGAGGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959649242_959649247 16 Left 959649242 3:108735805-108735827 CCTTGGTCCTGCAACTGATCTTT No data
Right 959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG No data
959649243_959649247 9 Left 959649243 3:108735812-108735834 CCTGCAACTGATCTTTGTTGTTC No data
Right 959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959649247 Original CRISPR CTGTCCCTGCAGAGGTGTCC AGG Intergenic
No off target data available for this crispr