ID: 959649504

View in Genome Browser
Species Human (GRCh38)
Location 3:108737923-108737945
Sequence CATAATTCATCCCTTAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959649504_959649514 25 Left 959649504 3:108737923-108737945 CCCACCCTAAGGGATGAATTATG No data
Right 959649514 3:108737971-108737993 TGGGCCAGCCTATAAAGTCCTGG No data
959649504_959649513 6 Left 959649504 3:108737923-108737945 CCCACCCTAAGGGATGAATTATG No data
Right 959649513 3:108737952-108737974 AGGTGCAAGTCACAGGAAGTGGG No data
959649504_959649512 5 Left 959649504 3:108737923-108737945 CCCACCCTAAGGGATGAATTATG No data
Right 959649512 3:108737951-108737973 GAGGTGCAAGTCACAGGAAGTGG No data
959649504_959649511 -1 Left 959649504 3:108737923-108737945 CCCACCCTAAGGGATGAATTATG No data
Right 959649511 3:108737945-108737967 GGGAAAGAGGTGCAAGTCACAGG No data
959649504_959649515 26 Left 959649504 3:108737923-108737945 CCCACCCTAAGGGATGAATTATG No data
Right 959649515 3:108737972-108737994 GGGCCAGCCTATAAAGTCCTGGG 0: 19
1: 47
2: 61
3: 56
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959649504 Original CRISPR CATAATTCATCCCTTAGGGT GGG (reversed) Intergenic
No off target data available for this crispr