ID: 959650119

View in Genome Browser
Species Human (GRCh38)
Location 3:108743357-108743379
Sequence CAAATTAAAGAGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 357}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959650119 Original CRISPR CAAATTAAAGAGAAGGTGGC AGG (reversed) Intergenic
901844343 1:11972546-11972568 GAAATGAAAGGGAAGGAGGCCGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
905140933 1:35843737-35843759 ACAGTTAAGGAGAAGGTGGCAGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
908269362 1:62408051-62408073 AAAATTAAAGGGAACTTGGCCGG - Intergenic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908790783 1:67779295-67779317 CAAATCACAGAGACGGAGGCTGG + Intronic
909293042 1:73908834-73908856 CAATTAAAATAGAAGGTGACAGG + Intergenic
910176405 1:84435520-84435542 CAGATTCAAGAGAAGCTGGGAGG + Intergenic
910799421 1:91130946-91130968 AAAATTAAAAAAAGGGTGGCTGG + Intergenic
912601210 1:110934772-110934794 CAACCTAAAGGGAAGGAGGCGGG + Intergenic
912755398 1:112321048-112321070 AAAACTAAAGAGAAGGTCCCAGG + Intergenic
913709630 1:121469711-121469733 CAAATTAAAGAGAAGGCTATGGG - Intergenic
916342975 1:163756934-163756956 GAAATTAAAAAAAAAGTGGCAGG - Intergenic
917609418 1:176671429-176671451 CAAAATATCCAGAAGGTGGCTGG + Intronic
918721292 1:187855579-187855601 CAAATTAAAAACATGATGGCTGG - Intergenic
919483804 1:198121540-198121562 TGAATTAAAGAGAAAGTGGGAGG - Intergenic
920396338 1:205648766-205648788 GGAATTGAAGAGAAGGGGGCAGG - Intergenic
920578352 1:207080025-207080047 CATATAAAAGTGAGGGTGGCGGG + Intronic
921076298 1:211702741-211702763 CAAATGAAAGAGGTAGTGGCGGG + Intergenic
921922410 1:220684488-220684510 CAACTTAAAAGGAAGGTGGGGGG - Intergenic
922282604 1:224140642-224140664 CATATTAAAGAGAATATAGCAGG + Intronic
923205549 1:231755335-231755357 AATATTAAAGAGAAAGGGGCTGG - Intronic
923749907 1:236737919-236737941 CAATTTAGAGAGGAGGTGGCTGG - Intronic
923907329 1:238399801-238399823 CAAACACAAGAGAAGGTGGTAGG + Intergenic
924111468 1:240703792-240703814 GAAAATAAAGAGATGTTGGCTGG - Intergenic
924579645 1:245312852-245312874 CAAATTCAAGGGAAGATGGATGG + Intronic
1063479417 10:6361238-6361260 CAAAATAAAGTGCAGGTGACTGG - Intergenic
1064363520 10:14686814-14686836 CAAATTGAAGAGAGAGGGGCAGG + Intronic
1065027326 10:21551219-21551241 GAAATCAAAGATAAGTTGGCCGG - Intronic
1065027715 10:21554754-21554776 AAAATTAAAGTGAAGGGGCCGGG - Intronic
1065886644 10:30083729-30083751 CATAAGAAAGAAAAGGTGGCTGG + Intronic
1066466323 10:35653536-35653558 CAAAGTCAAAAGATGGTGGCAGG + Intergenic
1066473356 10:35720754-35720776 CAAATTAAATGGAAGGTTGAAGG + Intergenic
1066503630 10:36019501-36019523 GACATCAAAGAGAAGCTGGCTGG - Intergenic
1069615672 10:69804642-69804664 CAAAAAAAAAAAAAGGTGGCAGG - Intronic
1070467526 10:76738642-76738664 CAAACTACAGAGAAGGGGCCTGG - Intergenic
1072930792 10:99659910-99659932 CAAAAGAAAAAGAAGGTGACAGG + Exonic
1073509804 10:104035667-104035689 GAAAGAAAAGAGATGGTGGCAGG + Intronic
1074107465 10:110399059-110399081 CCAATAAGAGAGGAGGTGGCAGG - Intergenic
1074473109 10:113745061-113745083 CAACTTAAATAGAAGGTGAAAGG + Intergenic
1074672363 10:115806448-115806470 AAAATGAAAGAGGGGGTGGCCGG + Intronic
1075111429 10:119588638-119588660 AAAATGAAATAAAAGGTGGCCGG - Intronic
1075356998 10:121788602-121788624 CAAATGAAAGATAAGGGGGTGGG - Intronic
1076095820 10:127734680-127734702 AAAATTCAAGAGAATGTGGAAGG + Intergenic
1076736674 10:132462166-132462188 TAAATTACACAGAAGGTGGTTGG + Intergenic
1077620051 11:3713419-3713441 AAAAATAAAGAGAATTTGGCTGG + Intronic
1077981074 11:7301390-7301412 CATATTAAAAAGCAGGTGGGTGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079389656 11:20010502-20010524 CAAATTAAAAAAAAGGTGGTGGG - Intronic
1079987114 11:27211070-27211092 CCAATAAAAGAGAATCTGGCTGG + Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1083340893 11:61957678-61957700 CATATTAAAGAGAGGTTGGCCGG + Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084427056 11:69090001-69090023 TAAATGAAAGAGAAAGGGGCAGG - Intronic
1085200538 11:74699214-74699236 AAAATTGGAGAGAAGGTGGCAGG + Intronic
1085837192 11:79969698-79969720 CAAATGAATGAGAGGGTGGAAGG + Intergenic
1085978164 11:81685987-81686009 CAAATTAAATGTAAGTTGGCGGG - Intergenic
1086630413 11:89011467-89011489 TATATTACAGAGAAGTTGGCAGG + Intronic
1086644265 11:89199707-89199729 AAGATTACAGAGAAGGTGGCAGG - Intronic
1089736934 11:120556117-120556139 TACATTGAAGAGAAGATGGCGGG + Intronic
1090768815 11:129900535-129900557 CAAATTAAAAAGAACGTAACAGG + Exonic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1092003629 12:5050823-5050845 CAAGTAAAAGAGAAGGTAACAGG - Intergenic
1092529890 12:9335416-9335438 AAAATGAAAGAGAAGGTGCTGGG - Intergenic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1094150744 12:27280310-27280332 GAAAATAAAGAAAAGGTAGCTGG - Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1095698947 12:45171203-45171225 CAAAATAATCAGAAGGTTGCTGG + Intergenic
1095823972 12:46512189-46512211 CAAAATAAACATAAGGTGGAAGG - Intergenic
1097016841 12:55993242-55993264 TGAATTAAAAAGAAGGTGGGAGG - Exonic
1098942726 12:76556620-76556642 CAATTTTTAGTGAAGGTGGCTGG - Intronic
1099352446 12:81590729-81590751 CATCTTAAATAGATGGTGGCAGG - Intronic
1099413192 12:82357819-82357841 CAAATTAAAGCGAAGGCTGGAGG + Intronic
1100084379 12:90890939-90890961 TAAATGAAAAAGAAGGAGGCAGG - Intergenic
1100116633 12:91313483-91313505 GAAATGAGAGAGAAAGTGGCTGG + Intergenic
1100237086 12:92672061-92672083 GAAAAAAAAGAGGAGGTGGCCGG - Intergenic
1100762622 12:97826088-97826110 CAAAGTAAAGGGAAAATGGCAGG + Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101621650 12:106394727-106394749 CAGATTAGTGAGAAGATGGCAGG + Intronic
1102185297 12:110942967-110942989 CAAAATAAAGAGTTGGGGGCAGG + Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103583909 12:121936912-121936934 GACATGAAAGAGCAGGTGGCAGG + Intronic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1103920388 12:124396356-124396378 AAAATTAAATAAAAGGCGGCGGG + Intronic
1106071942 13:26420847-26420869 CAGATCAAAGCTAAGGTGGCTGG - Intergenic
1106367024 13:29091229-29091251 CAAACAAAAGAGAAAGGGGCAGG - Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1108376503 13:49818977-49818999 CTAAATATAGAAAAGGTGGCTGG + Intergenic
1108563420 13:51670048-51670070 CAAATTACAGACAAACTGGCTGG - Intronic
1108752374 13:53461381-53461403 AAAATTGAAGAGTAGGTGCCAGG - Intergenic
1108842855 13:54642170-54642192 CAAAATAATGAGAAAGTAGCCGG + Intergenic
1109015275 13:57002497-57002519 CAAATTAAAGTACATGTGGCAGG - Intergenic
1109614938 13:64820540-64820562 CAATTGAAAGACAAAGTGGCTGG + Intergenic
1110687245 13:78389362-78389384 CAAATAAAATAGAAAGTGGCAGG + Intergenic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1112598618 13:100832923-100832945 CAAACTTAAGACCAGGTGGCAGG - Intergenic
1112921426 13:104617158-104617180 CATATAAAAGAGAAGGTGTGTGG - Intergenic
1113007569 13:105724367-105724389 CAAATTAAAGGTAAGATTGCTGG - Intergenic
1113737266 13:112687962-112687984 CACTTATAAGAGAAGGTGGCCGG - Intergenic
1114407218 14:22468133-22468155 AACATCAAGGAGAAGGTGGCTGG + Intergenic
1115076361 14:29396674-29396696 AAAATAAAACAGAAGGTAGCTGG - Intergenic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1116060760 14:39921437-39921459 AAAATTAAAAAGAAGGTGTGTGG - Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1117792549 14:59356379-59356401 TACATTAAAAATAAGGTGGCAGG - Intronic
1118164326 14:63321262-63321284 TAGATTGAAGGGAAGGTGGCAGG - Intergenic
1118922870 14:70166092-70166114 CAAATTAAAGAAGACGTGCCTGG + Intronic
1119309720 14:73635608-73635630 CCAATTAAAGTAAAAGTGGCTGG - Intergenic
1121281015 14:92698191-92698213 CTAATTAAATAGATGGTGGATGG + Intergenic
1124398428 15:29327291-29327313 TAACTTTAAAAGAAGGTGGCTGG + Intronic
1124567009 15:30825180-30825202 AAAGTTAAAGACAAAGTGGCTGG + Intergenic
1124959802 15:34385792-34385814 CAAATTAAAGTGATGGAGGGTGG + Intronic
1124976429 15:34532013-34532035 CAAATTAAAGTGATGGAGGGTGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126742917 15:51796397-51796419 CACACTGCAGAGAAGGTGGCAGG - Intronic
1128070322 15:64791751-64791773 CTAATTACAGAGAAGTTGACAGG + Intergenic
1128858193 15:71039335-71039357 AAAATGAAAGCCAAGGTGGCAGG + Intronic
1133128209 16:3660338-3660360 CAAATGAAAGTGAAGCTGGCTGG + Exonic
1134239860 16:12497600-12497622 CAAATACAAGAGAAGGAGACTGG - Intronic
1134926219 16:18162643-18162665 CAAAGCAACGAGAAGGTGGTTGG + Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137428950 16:48402734-48402756 TAAATAAAAAAGAAAGTGGCTGG - Intronic
1137586796 16:49668609-49668631 CAAGATACAGGGAAGGTGGCAGG + Intronic
1137904015 16:52300600-52300622 CATTTTATAGAGAAGGTGACTGG - Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1139647743 16:68343837-68343859 TAAATTAAAGACCAGGTGGGTGG + Intronic
1139828089 16:69773473-69773495 GAAAAAAAAGAAAAGGTGGCTGG - Intronic
1140244442 16:73235377-73235399 TAAAATAAAGAAAAAGTGGCCGG - Intergenic
1140326890 16:74013157-74013179 GAAATTGAAGAGAACGTGGAAGG - Intergenic
1140594350 16:76391366-76391388 CAAATTAGAAAGACTGTGGCTGG - Intronic
1140723120 16:77788722-77788744 CAAATGATCGAGAAGGAGGCAGG + Exonic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1143935444 17:10479589-10479611 TGAATTAAAGAGTAGGTGGGAGG + Intergenic
1145956787 17:28860271-28860293 TAAAAAAAAGAGAGGGTGGCCGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147336782 17:39730822-39730844 CAAAAGAAAGAGAAAGTGGTGGG + Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148598351 17:48875122-48875144 CATATTAATTTGAAGGTGGCGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149234707 17:54576533-54576555 CAAATAATAGAGTAAGTGGCAGG + Intergenic
1149796444 17:59524861-59524883 CAAATTACAGAGCAGCTGCCTGG - Intergenic
1149903780 17:60506356-60506378 CAAAAGAAAGCTAAGGTGGCAGG - Intronic
1150363801 17:64562672-64562694 TAAATTAGAGAGAAATTGGCCGG - Intronic
1150786118 17:68164154-68164176 CAATGTAAAGAAAAGGTGGCCGG + Intergenic
1150962244 17:69926600-69926622 GAAAGCAAAGAGAAGGTGCCAGG - Intergenic
1151611768 17:75181139-75181161 CATATTAATTTGAAGGTGGCGGG - Intergenic
1151742291 17:75991812-75991834 CAACTCAAAGACAGGGTGGCTGG + Intronic
1153682382 18:7512831-7512853 CAAATGAAAGAGAAGGGAGGGGG - Intergenic
1154075176 18:11193213-11193235 CAAAGTAAAGGGAAGGGGCCAGG - Intergenic
1155049931 18:22138087-22138109 CAAATTAAAAAAAAGGGGGGGGG - Intergenic
1156261617 18:35449590-35449612 TAAAATAAAGAGATGTTGGCAGG + Intronic
1156571687 18:38262732-38262754 CAAATCACACAGAAGGTGGCAGG - Intergenic
1156916702 18:42470446-42470468 CAAATGAAATAGAAGGTGGGAGG - Intergenic
1157373162 18:47137066-47137088 CATATTAACTTGAAGGTGGCAGG + Intronic
1158957363 18:62552600-62552622 CCAATTAAAAAGTAAGTGGCTGG + Intronic
1160129783 18:76214567-76214589 GAAATTAAAGAGCAGGTGCTTGG + Intergenic
1160254970 18:77240449-77240471 CAAAATAACTAGAAGGGGGCTGG - Intergenic
1161715100 19:5871624-5871646 CAATTTAAAAATAAGGTGGCTGG + Intronic
1162067317 19:8133846-8133868 CTAATTTAATGGAAGGTGGCAGG + Intronic
1162084647 19:8241123-8241145 CAGCTTTAAGGGAAGGTGGCAGG + Intronic
1164131622 19:22368326-22368348 CAAATGAAAGAGAAGGAAGTAGG + Intergenic
1165084070 19:33330530-33330552 AAAATTAAAGAGTGGCTGGCTGG + Intergenic
1165573026 19:36791484-36791506 CAAATTACGGAGGAGGGGGCAGG - Intergenic
1165580838 19:36862155-36862177 AAAGATAAAGAGAAGTTGGCCGG - Intronic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1165960500 19:39530235-39530257 CAAACAAAAAATAAGGTGGCTGG + Intergenic
1166662570 19:44656991-44657013 TAAATTAAAGAGAAGGGGATGGG + Intronic
1167180654 19:47900754-47900776 CAAACTTAAGAGTAGATGGCTGG - Intergenic
1168224010 19:54981535-54981557 CCAATTAGAGAAAAGGAGGCAGG - Intronic
925381672 2:3431922-3431944 CAGATTAAAAAGATGGTGGTGGG - Intronic
925970675 2:9104632-9104654 CAAATAAAAGGAAAGGGGGCCGG + Intergenic
927624574 2:24701206-24701228 TATATTAAAAAGTAGGTGGCTGG + Intronic
929852517 2:45605605-45605627 CAATTAAAAGAGTAGCTGGCTGG + Intronic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
930356411 2:50326591-50326613 CAAACTGAAGATAAGGTTGCAGG - Intronic
930684718 2:54295753-54295775 CACACAAAAAAGAAGGTGGCAGG - Intronic
932488631 2:72104246-72104268 AAGTTTAAAGGGAAGGTGGCAGG - Intergenic
932943943 2:76204755-76204777 CAAATTTAACAGAAGGGGGCAGG - Intergenic
934783577 2:96988536-96988558 CAAATTAAAGGTTGGGTGGCTGG + Intronic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
937505938 2:122536422-122536444 GAAATTTCAGAGAAGCTGGCAGG + Intergenic
937627135 2:124056228-124056250 CAAATTAGAGAGAAGCTGGTCGG + Intronic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
938053588 2:128196688-128196710 GGAATAAAACAGAAGGTGGCAGG + Intergenic
939721826 2:145663240-145663262 AAATATAAAGAAAAGGTGGCCGG - Intergenic
940011950 2:149063752-149063774 CAAATTATAGAAAAAGTAGCCGG + Intronic
941343924 2:164344109-164344131 CAAAATAAAGAGATGTTGGGAGG + Intergenic
941646075 2:168042872-168042894 AAAATTAGAAGGAAGGTGGCTGG - Intronic
943551910 2:189351722-189351744 TAAATTAATGAAAAGGGGGCAGG + Intergenic
943844467 2:192626185-192626207 CGAGAAAAAGAGAAGGTGGCGGG + Intergenic
943981056 2:194550950-194550972 CAAATTTAAGAGAAGTGTGCTGG + Intergenic
944315636 2:198282824-198282846 TAATTTAAAGAGTAGGTGGGAGG + Intronic
945272149 2:207951837-207951859 TAAAGTAGAGAGAAAGTGGCTGG - Intronic
946311580 2:218885009-218885031 CTCATTACAGAGAAGGTGTCAGG - Intronic
947057185 2:226118561-226118583 CAAATTACAGAGAAGATGCACGG + Intergenic
947060978 2:226164751-226164773 CAGATTCAAGTGAAGGTGGCAGG - Intergenic
947617182 2:231565721-231565743 CAAATTAAAAAACAGTTGGCTGG + Intergenic
947690917 2:232135120-232135142 CAAATAGAAGTGAAGGTTGCTGG + Intronic
947818996 2:233057826-233057848 CACATTCAAGAGAATATGGCTGG + Intergenic
1169806331 20:9563211-9563233 CAAATTTGAGAGAAAATGGCAGG + Intronic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170406243 20:16040996-16041018 CAAATTAAAGAGAACTTAGAAGG + Intronic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1172038530 20:32027726-32027748 CAATTTAGAGACAAGGAGGCAGG + Intronic
1172715993 20:36964205-36964227 CACATTAAAGAGGAGTAGGCCGG + Intergenic
1172718537 20:36981976-36981998 CACATTAAAGAGGAGTAGGCCGG - Intergenic
1173592152 20:44233178-44233200 GCAGTGAAAGAGAAGGTGGCGGG - Intergenic
1173798260 20:45877875-45877897 CAAATTAAAGAGAGCTCGGCCGG + Exonic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174744555 20:53048565-53048587 CAAATCAAAGAGCTGGTGGTAGG - Intronic
1177296225 21:19179982-19180004 CAAGTTAAAAAGAAGCTGACAGG + Intergenic
1180347524 22:11716322-11716344 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1180355289 22:11834432-11834454 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1180382962 22:12157895-12157917 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1181543272 22:23585677-23585699 AAAATAAAAGAGAAAGTAGCTGG - Intergenic
1182305380 22:29364404-29364426 AAAATAAAAGAGAAGGGGTCAGG - Intronic
1183670863 22:39271776-39271798 AAAAAAAAATAGAAGGTGGCTGG - Intergenic
1183683927 22:39350778-39350800 CAATTTATAGACAAGGTGGGCGG + Intronic
951707911 3:25562330-25562352 GAAATTAAAGACACTGTGGCTGG - Intronic
952018586 3:28989449-28989471 CAAATTACAGAGAAGTTGAGGGG - Intergenic
952354745 3:32573663-32573685 CAAATGAAAAAGAAGATGGTTGG - Intergenic
952414402 3:33077252-33077274 CATATTAATTTGAAGGTGGCAGG + Intronic
952767693 3:36969365-36969387 CTAATGAAAGAAAAGGAGGCTGG + Intergenic
953627488 3:44582834-44582856 CAAATGAAAGAGTAGGTGAAAGG + Intronic
953915290 3:46915783-46915805 CAAAAGAAAGTGGAGGTGGCAGG - Intergenic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
955806024 3:62735761-62735783 CAAAGAAAAGAAAAGGTGGTAGG - Intronic
955821577 3:62901531-62901553 CAAAGTACAGAGAAGATGGTGGG - Intergenic
957373296 3:79324319-79324341 CAAATTAGAGAGAAGTTTTCTGG + Intronic
957943991 3:87038672-87038694 ATAATAAAAGAGTAGGTGGCTGG + Intergenic
958558873 3:95717231-95717253 CAAGTTAAAGAGAAAGGGACAGG - Intergenic
959632058 3:108517762-108517784 GAATTTAATCAGAAGGTGGCCGG - Intronic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
965742852 3:171894358-171894380 CAAATTCAAGAGCAGGCTGCAGG + Intronic
966139354 3:176737328-176737350 CAAATTAAAGATACAGTGGGAGG - Intergenic
966768042 3:183479819-183479841 CAAAGCAAAGAAAAGCTGGCAGG + Intergenic
968139685 3:196245700-196245722 CAAAGTAAAGAATAGGAGGCCGG + Intronic
972511767 4:39773623-39773645 AAAACTAACAAGAAGGTGGCTGG + Intronic
972974856 4:44621663-44621685 CAAATTTAAGAGAATGTAGTGGG + Intergenic
973372876 4:49266186-49266208 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
973388121 4:49528873-49528895 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
976244032 4:82989689-82989711 GAAATTAAAGAGTAGGAGGAGGG + Intronic
976345859 4:84000115-84000137 CTAATAAAATAGAAGGTGGTTGG + Intergenic
976852116 4:89559596-89559618 CAATTTACAGAGAATTTGGCAGG + Intergenic
977360152 4:95993172-95993194 CAAATTAAAGGTAGGGTGGTAGG + Intergenic
977594959 4:98868369-98868391 CAAATTAAAAAGAAGCTGGAGGG - Intergenic
977654071 4:99502080-99502102 CAAATTAAAGAGAAAATGTGTGG - Intergenic
979282522 4:118883747-118883769 CAAATAAAATAAAAGGAGGCGGG + Intronic
979620613 4:122794907-122794929 TAAGTTAAAGAGAATGTTGCTGG + Intergenic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981208931 4:142078067-142078089 AAAATTAAACACAAGGTGTCTGG - Intronic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
986308352 5:6532294-6532316 TGAATTAAAAAGAAGGTGGGAGG + Intergenic
987815683 5:22898853-22898875 CAAACTAAAGAAAATGTTGCAGG - Intergenic
989967244 5:50478852-50478874 CAAATTAAAGAGAAGGATATAGG + Intergenic
992073184 5:73167391-73167413 CAAATTGAAGTTAAGGTGCCAGG - Intergenic
992134615 5:73731562-73731584 CAACTAAAAGAGAAGTTTGCTGG - Intronic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
994120767 5:96110192-96110214 CAAATTACAGTGGGGGTGGCTGG + Intergenic
994176063 5:96712623-96712645 AATATTAAAGAGATGGTCGCTGG - Intronic
994313848 5:98309047-98309069 AAAATTAAATAGAAAGTGGGAGG + Intergenic
994610084 5:102024924-102024946 CAAAAAAAAGAGTAGGTTGCAGG + Intergenic
996215812 5:120864078-120864100 CCAAGTTCAGAGAAGGTGGCTGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996601589 5:125270499-125270521 AAAATTAAAGAGAAACAGGCTGG + Intergenic
996607093 5:125335890-125335912 TAAATTATAGAGAATGTGGATGG + Intergenic
997938744 5:138137609-138137631 AAAAATAAAGAGAAAATGGCGGG - Intronic
998561039 5:143171779-143171801 CAAATTGAAGAGGTGGTAGCAGG + Intronic
999122552 5:149220399-149220421 ATAATTAATGAGAAGGTGACAGG - Intronic
1000308695 5:160020179-160020201 GAAATGAAAGAAAAGGAGGCTGG - Intronic
1000626460 5:163545012-163545034 TAGATTAAAGAGCAGGCGGCCGG - Intergenic
1001055923 5:168449868-168449890 CAAATAAAAGAGCTGTTGGCGGG - Intronic
1001197906 5:169690311-169690333 GAAATTACAGAGAAGGAGCCAGG + Intronic
1001454652 5:171851468-171851490 CAAGTTAAAGAAAAGGAAGCAGG - Intergenic
1001682853 5:173571308-173571330 AAAACTAAAGAGAAGGTTGTAGG - Intergenic
1001803296 5:174561824-174561846 CATATTAATTTGAAGGTGGCGGG + Intergenic
1003328424 6:5110019-5110041 CACTTTAAAAAGAAGGGGGCAGG - Intronic
1003501580 6:6707555-6707577 CAGATGAAAGAGAACTTGGCTGG - Intergenic
1003722873 6:8724678-8724700 GATATTAAAGAAAAAGTGGCAGG + Intergenic
1003866668 6:10369535-10369557 AAAATAAAAGACAAGGTGGCTGG + Intergenic
1004281286 6:14281589-14281611 CTACTTGAAGAGAAGGTGACAGG - Intergenic
1005826692 6:29636273-29636295 CATATTAATTTGAAGGTGGCGGG - Intergenic
1005945580 6:30593006-30593028 TAAATTAAAAATAAGGAGGCCGG + Intronic
1006167861 6:32075836-32075858 AAAATGGCAGAGAAGGTGGCTGG + Intronic
1007293092 6:40801801-40801823 CTAAGTGAAGAGAGGGTGGCAGG + Intergenic
1010437033 6:75843716-75843738 AAAATAAAAGAGAAGGGAGCAGG - Intronic
1010823225 6:80440944-80440966 CAAATTACAGTCCAGGTGGCTGG + Intergenic
1010914449 6:81598573-81598595 AAAATTAAACAGGAGGTGGTTGG - Intronic
1011666436 6:89638975-89638997 CAAATGAAAGTGAAGGAGGCCGG + Intergenic
1011962281 6:93105937-93105959 CAAATTGAAGAGAAACTCGCTGG - Intergenic
1013527757 6:110990568-110990590 CAAACAAAAGAAAAGGTGGGGGG - Intronic
1013690473 6:112636230-112636252 CAAATAGAAGAGATGGTAGCGGG - Intergenic
1013787617 6:113799282-113799304 CAAAATGAAGAGTAGGTGGTGGG - Intergenic
1013884335 6:114944832-114944854 CATATTACATAGATGGTGGCCGG + Intergenic
1014732563 6:125050718-125050740 CAACTTAAAGTGATGGTGTCAGG - Intronic
1015115548 6:129645128-129645150 CAAATTAAAAAATACGTGGCAGG - Intronic
1015826600 6:137318969-137318991 CAAATCAAATAGAAGGTCACTGG + Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016930342 6:149400440-149400462 CATATTAATTTGAAGGTGGCGGG + Exonic
1017278134 6:152593958-152593980 GAAGTTAATGAGAAGGTGGGTGG - Intronic
1017551725 6:155516930-155516952 CAAATGAGGGAGAAGGTGGGTGG + Intergenic
1019978982 7:4606997-4607019 GAAAATAAAGAGAGGCTGGCTGG - Intergenic
1020814479 7:12888476-12888498 AAAAGAAAAGAAAAGGTGGCTGG - Intergenic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1022590360 7:31655416-31655438 CAGTTTGGAGAGAAGGTGGCTGG - Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023920517 7:44625974-44625996 AAAATTTAAAAGAAGGTGGGGGG + Intronic
1024313635 7:47992853-47992875 CAAATTAAAGAAAAATAGGCTGG + Intronic
1024930380 7:54662767-54662789 GAAATGTAAGAGAAGGTGGCTGG + Intergenic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1026645145 7:72160994-72161016 CAAGTTAAACAGAAGCTGGCAGG + Intronic
1027000732 7:74652323-74652345 CAAACAAAAGAAAAAGTGGCTGG + Intergenic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1029787898 7:102810879-102810901 AAAATTAATGAAAAGGAGGCTGG - Intergenic
1029987370 7:104934500-104934522 GGAATTAAGGAGAAGGTGGGTGG - Intergenic
1031006479 7:116478762-116478784 TAAATTAAATAGGAAGTGGCTGG - Intronic
1033017559 7:137687274-137687296 CAAATAAAAAGGAAGGTGGCAGG - Intronic
1035032018 7:155867043-155867065 CAAATCAAAGAGGAGTTGGGAGG + Intergenic
1035176509 7:157055878-157055900 CACATTAAAGGGCAGGTGACTGG + Intergenic
1038971984 8:32646745-32646767 CAAATCAAAGAGAGGCAGGCAGG - Intronic
1042082246 8:65067515-65067537 CTAAGTAAAAAGAAGATGGCTGG - Intergenic
1042574061 8:70198707-70198729 GAGGTAAAAGAGAAGGTGGCTGG + Intronic
1042991079 8:74640537-74640559 CAATTCAAAGAGAAAGAGGCAGG + Intronic
1043055311 8:75430448-75430470 CAAATAAAAGAGACGGGGGTAGG + Intronic
1043364016 8:79510485-79510507 CAGATCCAAGAGATGGTGGCTGG + Intergenic
1043387626 8:79764150-79764172 TAAATCAAAGAGAAGGAGGCAGG + Exonic
1043830495 8:84982765-84982787 GAAATTAAAGAGAGGGAGGTTGG + Intergenic
1045982667 8:108209807-108209829 GAAATTAAGGACAGGGTGGCAGG + Intronic
1047526302 8:125637313-125637335 CATATGAAAGGCAAGGTGGCAGG + Intergenic
1048560927 8:135536662-135536684 CAGATTTAAGAGATGTTGGCCGG + Intronic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050490539 9:6183975-6183997 CAGATTAAAGAGAGGTTGGTTGG + Intergenic
1050607087 9:7313519-7313541 AAAAATAAAGAAAAGGGGGCTGG - Intergenic
1051066017 9:13104002-13104024 CACATTAAAGAGAAAATGGAAGG - Intergenic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1053655607 9:40215785-40215807 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1053905970 9:42845001-42845023 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054367725 9:64362015-64362037 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054528999 9:66160507-66160529 CAAGTAAAAGAGGAGGTGGATGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054675342 9:67851750-67851772 CAAGTAAAAGAGGAGGTGGATGG - Intergenic
1055262842 9:74458878-74458900 CAAATTAAAGAGACAGCGTCAGG - Intergenic
1056118858 9:83467184-83467206 CAAATTATGGAGAAAATGGCAGG + Intronic
1056384134 9:86081522-86081544 CAAATACAAGAGGGGGTGGCAGG + Intronic
1057473549 9:95379832-95379854 CAAATGAGAGAAAAGGTGGCAGG - Intergenic
1057478382 9:95424951-95424973 CAAATTAAAAGTAAAGTGGCCGG + Intergenic
1058297597 9:103328189-103328211 CAAGTTAAAGAAAAGGTGGTAGG + Intergenic
1059663556 9:116425055-116425077 GAAATTATAGAGAAGGAGTCTGG - Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1203696590 Un_GL000214v1:104212-104234 CAAGTAAAAGAGGAGGTGGACGG + Intergenic
1203552630 Un_KI270743v1:176816-176838 CAAGTAAAAGAGGAGGTGGACGG - Intergenic
1185725775 X:2420446-2420468 TAAAATAAAGAGAATGGGGCCGG + Intronic
1185789648 X:2919169-2919191 CAAAATAAAAATAAAGTGGCAGG + Intronic
1189588692 X:42488823-42488845 CAAATGAAGGAAAAGATGGCTGG - Intergenic
1189657078 X:43255739-43255761 CCAATGAAAGAGAAGGGGCCAGG - Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1189907223 X:45773813-45773835 CAAAATGAAGAGAGGGTGGTTGG + Intergenic
1190005719 X:46735913-46735935 AAAACTAAAGACAAGGTGTCTGG - Intronic
1193319993 X:80109970-80109992 GAAATGAAAGTGAAGGTGGATGG + Intergenic
1193378345 X:80788265-80788287 CAATTTAAAAAGATGGGGGCAGG + Intronic
1195890642 X:109689699-109689721 CAATTTTAAAAGAAGTTGGCTGG - Intronic
1196440867 X:115719159-115719181 CATATTAATTTGAAGGTGGCGGG - Exonic
1196485394 X:116201172-116201194 CAAAATAATAAGAAGATGGCAGG - Intergenic
1196593468 X:117516160-117516182 CAAGTCAAAGAGAAGGTTGATGG - Intergenic
1196804206 X:119570377-119570399 CAATTTAAAGAAAAGTGGGCTGG - Intergenic
1197206584 X:123796449-123796471 GAAACTAAAGATAAGGTGGCCGG + Intergenic
1197825805 X:130589104-130589126 TGAATTAAAGAGAAAGTGGGAGG - Intergenic
1198922030 X:141739850-141739872 CAAAGTAGAGAAAAGGTTGCTGG + Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201284796 Y:12369714-12369736 CAAAATAAAAATAAAGTGGCAGG - Intergenic
1201413121 Y:13721247-13721269 CATATTAAAGAGGAGGCTGCAGG + Intergenic
1202025200 Y:20514623-20514645 CAAAATAAATAGAAAGTGGATGG - Intergenic