ID: 959650346

View in Genome Browser
Species Human (GRCh38)
Location 3:108745002-108745024
Sequence TGGTGATGATGTGCCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959650341_959650346 10 Left 959650341 3:108744969-108744991 CCCGTGAGTCACAGGCATGGCCA 0: 1
1: 0
2: 0
3: 11
4: 195
Right 959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 149
959650342_959650346 9 Left 959650342 3:108744970-108744992 CCGTGAGTCACAGGCATGGCCAG 0: 1
1: 0
2: 1
3: 30
4: 310
Right 959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 149
959650336_959650346 20 Left 959650336 3:108744959-108744981 CCCCAGACATCCCGTGAGTCACA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 149
959650338_959650346 18 Left 959650338 3:108744961-108744983 CCAGACATCCCGTGAGTCACAGG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 149
959650345_959650346 -10 Left 959650345 3:108744989-108745011 CCAGAGGAACATCTGGTGATGAT 0: 1
1: 0
2: 1
3: 9
4: 101
Right 959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 149
959650337_959650346 19 Left 959650337 3:108744960-108744982 CCCAGACATCCCGTGAGTCACAG 0: 1
1: 0
2: 1
3: 7
4: 83
Right 959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959650346 Original CRISPR TGGTGATGATGTGCCCTGCA TGG Intronic
901652656 1:10752067-10752089 TGGGGAGGGTGTGCCCTGCAGGG - Intronic
902239010 1:15075910-15075932 GGGTGATGAAGTGCTCTGGAGGG - Intronic
904377718 1:30092247-30092269 TGTCCATGATGTGCACTGCAGGG - Intergenic
905836586 1:41128612-41128634 TGATGATGATGTGCCTTGTGTGG + Intronic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
906275024 1:44508959-44508981 TGATGCTGCTGTGCCCTCCAGGG - Intronic
906468118 1:46103286-46103308 TGGTTATGATGGGCCAGGCACGG + Intronic
909231333 1:73093959-73093981 TGGTCATGATGCTCCCTCCATGG + Intergenic
910555956 1:88532914-88532936 TAGTGAAAATGTGCTCTGCAAGG + Intergenic
912989934 1:114475342-114475364 TGATTATGATGTGCTTTGCATGG - Intronic
913069599 1:115286696-115286718 GGGGGATGGTGTGTCCTGCAGGG + Exonic
913344241 1:117792441-117792463 TGGTGAAGATGTGGTCTGCTTGG + Intergenic
915166004 1:153948093-153948115 TGGTGATGAGGTGCCCTCATTGG + Exonic
916339409 1:163712454-163712476 TTGTGCTGATGGGACCTGCAAGG + Intergenic
919003689 1:191867993-191868015 TGGTGTTGTTCTGCCCTGCTAGG - Intergenic
921901852 1:220459573-220459595 TGATGATGATGTGCTATGAATGG + Intergenic
922143027 1:222909029-222909051 TGAGGATGATGTGGGCTGCATGG + Intronic
923335105 1:232961629-232961651 TGGTGATTATTTTCCCTTCAAGG + Intronic
923461646 1:234214282-234214304 CGGGGAGGATGTGCGCTGCAGGG + Intronic
1067683745 10:48455493-48455515 TGGAGCAGCTGTGCCCTGCAGGG - Intronic
1068823992 10:61412222-61412244 TTGTCATAATGTGCCCTGGAAGG - Intronic
1072196646 10:93121848-93121870 TGATGATGTTGAGCCCAGCAAGG - Intergenic
1074332525 10:112530827-112530849 TGGTAATGATCTGCTCTGCCAGG - Intronic
1076585991 10:131547982-131548004 GGGTGCTGACCTGCCCTGCAAGG + Intergenic
1078583763 11:12561903-12561925 TGGGAATGATGTCCCCTCCAGGG - Intergenic
1079078025 11:17395704-17395726 CAATGATGATGTGCCCTGCATGG + Exonic
1083701174 11:64478553-64478575 TGGAGATTTTGTGCCCTGCATGG + Intergenic
1086398862 11:86444344-86444366 TGGTGATGAAGTGCCTTGTATGG + Intronic
1086898357 11:92338971-92338993 TGGGGATCATGTTCCATGCAAGG - Intergenic
1089515329 11:119028412-119028434 TGCTGGTGATGAACCCTGCAGGG + Exonic
1089983766 11:122794099-122794121 TAGTGATTTTGTGCCATGCATGG - Intronic
1090734942 11:129604330-129604352 TGGAGATAATGTGCCATGAATGG + Intergenic
1091997947 12:5009964-5009986 TGCTGAGGATGTTCCCAGCAGGG - Intergenic
1092686446 12:11053697-11053719 TGATGATGATGTCACCTGAAAGG + Intronic
1096491133 12:52013679-52013701 TGGCGATGGTGTCCCCTGCCAGG - Exonic
1096789668 12:54036963-54036985 TGGGGCTGGTGTGCCCTGCCTGG - Intronic
1098917719 12:76274552-76274574 TGGTGATGCTGTGCTCTCCCAGG + Intergenic
1102915917 12:116751962-116751984 TGGTGTTGCTGTGCCCTGGCGGG + Intronic
1104901952 12:132194244-132194266 TGTTGAAGATGGTCCCTGCACGG - Intergenic
1105935705 13:25096294-25096316 TGGAGAGGATGGGCCCTGCCGGG - Exonic
1106552425 13:30783722-30783744 TTGTGAGTCTGTGCCCTGCAAGG - Intergenic
1107176657 13:37407121-37407143 TGGTGTTGATGTCCTCTGGAAGG + Intergenic
1107511187 13:41086404-41086426 GGGTCATCATGTGCCATGCAGGG - Intergenic
1112486805 13:99827480-99827502 CGGGGATGATGGGCCATGCATGG - Intronic
1112580018 13:100670367-100670389 TGGTGATGCTGTCCCCTTCCAGG + Exonic
1113280943 13:108786761-108786783 TGGTGACGATGTGAGCAGCACGG - Intronic
1114967192 14:27977222-27977244 TGATTATGATGTGCTCTGGATGG + Intergenic
1121708308 14:96017785-96017807 TGGTGATCATGAGCTCTGTAAGG + Intergenic
1124104690 15:26726658-26726680 AGGTGATGCTGTGCCCTTCTTGG + Intronic
1124641807 15:31400593-31400615 TGGGGGTGAGGTGCCCTGCAGGG + Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1125795997 15:42404248-42404270 GGATGATAATGTGCCTTGCAAGG + Intronic
1127170690 15:56298088-56298110 TGTTGATTATGTGATCTGCATGG + Intronic
1128578871 15:68795067-68795089 TGGTGGTGGTGTGTGCTGCAGGG - Intronic
1130366993 15:83249650-83249672 TGGTGATGATGTGCCATACTGGG - Intergenic
1131542453 15:93286598-93286620 AGCTGATGATGGGCCCTGGATGG - Intergenic
1132891284 16:2206070-2206092 TGTTCATGGTGTGGCCTGCACGG - Exonic
1133144586 16:3775043-3775065 GGGTGAGGAGGTGCCCTGAAAGG + Intronic
1135233935 16:20738417-20738439 TCATGATGTTGTGCCCAGCATGG - Intronic
1136509434 16:30727127-30727149 AAGTGATGATGTGCCAGGCATGG - Intronic
1136659006 16:31738127-31738149 TGGTGATCATGTGCCATATATGG + Intronic
1137616079 16:49847830-49847852 TGGTTAAGATGGGCCATGCAAGG + Intronic
1139452370 16:67040848-67040870 AGGGAATGATGAGCCCTGCAGGG + Intronic
1141294412 16:82753527-82753549 AGGTGATGGTGGGCCATGCATGG - Intronic
1141894016 16:86947048-86947070 TGGAGATGATGAGGCCTGGAGGG - Intergenic
1142946024 17:3427940-3427962 TGGTGATCATGTCCTTTGCAGGG + Intergenic
1143353041 17:6303307-6303329 TGGTCTTGATGTGCACTTCATGG + Intergenic
1144456952 17:15426635-15426657 TGATGATGATGACGCCTGCATGG + Intergenic
1146663500 17:34681243-34681265 TGTTGATCCTGAGCCCTGCATGG + Intergenic
1151655039 17:75491879-75491901 TGGTGAAGAAGAGCCCAGCAAGG + Exonic
1151867882 17:76816444-76816466 TGGTGAGCATGGGTCCTGCAGGG - Intergenic
1153355545 18:4130908-4130930 TGGCGAGGATGTGGCCAGCAGGG + Intronic
1155517414 18:26637415-26637437 TGGTGCTGATGTGAGCTGCGAGG + Intronic
1157422761 18:47560163-47560185 TGATGATGATGTGCAGTGAAGGG + Intergenic
1162003243 19:7761290-7761312 TGGTGGGAATGTGCACTGCAGGG + Intergenic
1165063422 19:33215959-33215981 AGCCGATGATGTTCCCTGCAGGG + Exonic
925115274 2:1373355-1373377 TGCTGAGGCTGTGCCCTGGATGG - Intergenic
925724973 2:6863844-6863866 TTGTGATGATGTGCCTTGCCTGG - Intronic
927453923 2:23232956-23232978 GTGTGCTGATGTACCCTGCAGGG + Intergenic
930977968 2:57487747-57487769 TGCATATGATGTGCCCTGCTTGG - Intergenic
931448850 2:62350601-62350623 TGATGATGATGTGTCGGGCAGGG - Intergenic
932022311 2:68099644-68099666 TGGTAATGATGTGGCCAACAAGG + Intronic
939427490 2:142058236-142058258 TGTTAATGATGTGTCCTGCTGGG + Intronic
944634353 2:201660483-201660505 TGGTGATCATTTGCCTTGCCAGG - Intronic
946277938 2:218644644-218644666 TGGGGGTGTTGGGCCCTGCATGG + Exonic
948263993 2:236624430-236624452 TGGTGATGAGGTCCCCGTCAAGG + Intergenic
948352024 2:237348697-237348719 TGGTTATGGTGTGCCAGGCATGG - Intronic
1169466639 20:5847017-5847039 TGGTGATGATGGGCCGAGCAGGG - Intronic
1173981108 20:47224765-47224787 TGGACATGAGGTGCCCAGCATGG + Intronic
1175725035 20:61312446-61312468 TGGTGATCATGGGCCCTGCCTGG + Intronic
1175734543 20:61376250-61376272 TGGTGGTGATGTGCTTTGAAAGG + Intronic
1176187540 20:63789462-63789484 TGGTGAGGGCGTGGCCTGCAGGG - Intronic
1179382813 21:40915104-40915126 TGGTGAAGAGGTGCCCAGCATGG + Intergenic
1179658585 21:42860611-42860633 TGGTGCTGTGGTGCCGTGCAGGG - Intronic
1181779597 22:25183217-25183239 TGGGGATTGTGTGGCCTGCATGG - Intronic
1183284373 22:36953070-36953092 TGGTGATAAGGGACCCTGCAGGG - Intergenic
1183587756 22:38762770-38762792 TGGGGCTGATGAGCCATGCACGG - Intronic
1185025718 22:48410697-48410719 TGGTGATGATTCTCCCTGCCAGG + Intergenic
949711339 3:6874404-6874426 TGGTATTGATGTGGCCTGCCCGG - Intronic
950450854 3:13064588-13064610 TGGTGATGTGGTGCTCTGAATGG + Intronic
953701636 3:45200501-45200523 TGGTGACGAAGTCCCCTGAAGGG - Intergenic
953970480 3:47343469-47343491 GGGGGCTGCTGTGCCCTGCACGG + Intronic
954367901 3:50155781-50155803 TGTGGATGATGTGGCCTGCGGGG + Intronic
954457449 3:50607547-50607569 TGGGGCTGATGTCCCCTCCAGGG + Exonic
955084704 3:55691415-55691437 TGGTGCTGATGTGTATTGCATGG - Intronic
955466586 3:59243360-59243382 TGGTGATGAAGTCCCATGAATGG + Intergenic
959576814 3:107943511-107943533 TGGTAAGGTTGTGGCCTGCAGGG + Intergenic
959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG + Intronic
961360581 3:126364804-126364826 TGATGCTGATGGGCCCAGCAGGG + Intergenic
963248533 3:143084290-143084312 TGTTGATGAGGTGCCTTTCATGG + Intergenic
966514491 3:180802706-180802728 TGGTGATGTTTTGCACAGCAGGG + Intronic
971471067 4:27027649-27027671 TGGTGCTGTTTTGCCCTGCCAGG + Intergenic
973803424 4:54500621-54500643 TGGTGCTGCTGTGCCCATCAAGG - Intergenic
973845046 4:54903236-54903258 TGGTTATGATGTCACCTTCAAGG - Intergenic
979073496 4:116241220-116241242 AGCAGATGATGTGCCCTGCCAGG + Intergenic
979863505 4:125723929-125723951 TGGCGATGCTCTGGCCTGCATGG + Intergenic
986674933 5:10175788-10175810 TGGTGGTTATTTGCCATGCAGGG - Intergenic
990450812 5:55930154-55930176 TGGTGATGATGTCACCAGCTGGG - Intergenic
991558507 5:67923312-67923334 TGGTACTGAGGTGGCCTGCACGG + Intergenic
996109017 5:119543001-119543023 TGGTTATGACCTGCCCTGCAAGG + Intronic
997197222 5:131988212-131988234 CGGTGCTGATGTCCGCTGCAGGG + Exonic
997741115 5:136255816-136255838 TGGTTGTAATGTGCCCTGCTAGG + Intronic
1001290092 5:170450842-170450864 TCGTGATTATCTCCCCTGCAAGG + Intronic
1004252366 6:14032965-14032987 TGCAGGTGATGTCCCCTGCATGG + Intergenic
1007396741 6:41582351-41582373 TGCTTATTATGTGCCCAGCACGG - Intronic
1012423846 6:99093378-99093400 TAGTTATGATATGCCCAGCAGGG + Intergenic
1012992176 6:105937440-105937462 TGGTGATGATGTGCTTTCTAAGG - Intergenic
1013142658 6:107354225-107354247 TTGTGGTTATATGCCCTGCATGG - Intronic
1015603179 6:134930193-134930215 TGGTGGTGTTGTTCCCTGGAAGG + Intronic
1017941487 6:159057164-159057186 TGGTGATGAAGGGACCTGCTTGG + Intergenic
1022525568 7:31034936-31034958 AGGTGTTGAAGTGCCCTTCATGG - Intergenic
1026934105 7:74242238-74242260 TGTTGTTGATGTCCCCTGCACGG - Intronic
1030641985 7:112016343-112016365 AAGTGATGGTGTGCCCTGCTTGG + Intronic
1033724173 7:144095448-144095470 TGGTGATGATGTGCTATGATCGG + Exonic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035755620 8:2028985-2029007 TGGTGATGCTGGGGGCTGCATGG + Intergenic
1038256745 8:25957452-25957474 TGGTGAAGAGGTGGCCTGCGGGG - Intronic
1041146723 8:54883822-54883844 TGGTGCTGATGGGAGCTGCAAGG + Intergenic
1042406092 8:68406911-68406933 TGGTGGGGTTGTGCTCTGCATGG + Intronic
1044474190 8:92606840-92606862 TGGTGAAGATGTGGGCAGCAGGG - Intergenic
1044747056 8:95380843-95380865 TGCTCATGATGTGCCAGGCAGGG + Intergenic
1048876101 8:138837932-138837954 GGGTGAGGACGTGCCTTGCAGGG + Intronic
1053256684 9:36623201-36623223 TGGGGATGATTTGTCCTACAAGG - Intronic
1053384977 9:37679929-37679951 TGGTGTTGATGTGATCTGTAAGG - Intronic
1056503166 9:87230740-87230762 TCGTGATGATGTGCTTTACAAGG + Intergenic
1056786482 9:89596010-89596032 TGGTGATGCTGTGTCCTTCTTGG - Intergenic
1057249596 9:93489843-93489865 TGGTGATTCTGTACCTTGCAGGG + Intronic
1057787141 9:98095809-98095831 TGGTGATGTCTTGCCCAGCAGGG + Intronic
1058115937 9:101084253-101084275 TGAAGATGCTGTGCCCAGCAAGG + Intronic
1059127305 9:111702634-111702656 ATGAGATGATGTGCACTGCATGG + Intronic
1061305776 9:129732399-129732421 GGATGATGATGTACCGTGCAAGG + Intergenic
1062176171 9:135164298-135164320 TGCTGATGACGTCGCCTGCAAGG + Intergenic
1189578909 X:42384868-42384890 TGGTGGTGGTGTTTCCTGCAGGG + Intergenic
1189706872 X:43767591-43767613 TGGTGGTGATGGGCTGTGCAGGG + Exonic
1192145665 X:68680640-68680662 TGTTGGTGCTGTGCCCTGCCAGG + Intronic
1193244603 X:79213170-79213192 TAGTGATGTTGAGCACTGCATGG - Intergenic
1193637747 X:83973640-83973662 AGGAGATGATGTCCTCTGCAGGG + Intergenic
1194134776 X:90127472-90127494 TCTTGAAGATGTGTCCTGCATGG - Intergenic
1197180388 X:123529327-123529349 TGGGGATCATGTCCCTTGCAGGG - Intergenic
1199890245 X:152071850-152071872 TGGTGAGCATATGCCCTCCAAGG + Intergenic
1200480561 Y:3697583-3697605 TCTTGAAGATGTGTCCTGCATGG - Intergenic
1201747027 Y:17387947-17387969 TGGAAAAGATATGCCCTGCATGG + Intergenic