ID: 959650597

View in Genome Browser
Species Human (GRCh38)
Location 3:108746784-108746806
Sequence GGGGAGACATAGAATTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959650591_959650597 7 Left 959650591 3:108746754-108746776 CCATAGACCAGTAACACAAAATT 0: 1
1: 1
2: 0
3: 18
4: 245
Right 959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG 0: 1
1: 0
2: 0
3: 16
4: 279
959650589_959650597 24 Left 959650589 3:108746737-108746759 CCCTTGACTAATTCTCTCCATAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG 0: 1
1: 0
2: 0
3: 16
4: 279
959650592_959650597 0 Left 959650592 3:108746761-108746783 CCAGTAACACAAAATTTCAGCTG 0: 1
1: 0
2: 0
3: 12
4: 171
Right 959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG 0: 1
1: 0
2: 0
3: 16
4: 279
959650590_959650597 23 Left 959650590 3:108746738-108746760 CCTTGACTAATTCTCTCCATAGA 0: 1
1: 0
2: 1
3: 12
4: 154
Right 959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG 0: 1
1: 0
2: 0
3: 16
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959650597 Original CRISPR GGGGAGACATAGAATTAGAA TGG Intronic
901949485 1:12730741-12730763 GGGGAGGGATAGCATTAGGAGGG - Intergenic
902027787 1:13396638-13396660 TGGGAAACAAAGAATAAGAAGGG - Intergenic
904292787 1:29498419-29498441 GGGCAGACAGAGAAGGAGAAGGG + Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904834824 1:33328840-33328862 GGGGAGACATGGAATTTCCAAGG + Intronic
907695311 1:56720745-56720767 GGGGAGGGAGAGTATTAGAAAGG - Intronic
907961084 1:59282322-59282344 GGGGAGATAAAGAATGGGAAAGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
913239300 1:116815407-116815429 GTGCAGAAATAGAACTAGAAGGG - Intergenic
913295152 1:117312097-117312119 GAGGAAACAGAGAATTAGAAAGG + Intergenic
914864392 1:151414341-151414363 GGGAAAACATAGACTAAGAAAGG - Intronic
915836866 1:159183797-159183819 GGGGACAGACAGAGTTAGAAAGG + Intronic
916444527 1:164859931-164859953 AGGAAGAAATAGAATTAGACTGG + Intronic
917243550 1:172975255-172975277 GGGGAGACAGAGACTGAGAAGGG - Intergenic
919515107 1:198512668-198512690 AGGATGACATAGAATTTGAAGGG - Intergenic
919544193 1:198893293-198893315 TGGGAGACATGAAATAAGAATGG - Intergenic
920107712 1:203566070-203566092 GGGGAGACAGAGATTTAGACAGG - Intergenic
920429541 1:205908308-205908330 AGAGAGAGAGAGAATTAGAAAGG - Intergenic
921028503 1:211313651-211313673 GGGGTGGCATGGAATTAGCAGGG - Exonic
923710186 1:236382213-236382235 TTGGAGACATAGAAATTGAAGGG - Intronic
1063734057 10:8732495-8732517 GGGGAGATAGAAAAGTAGAAAGG - Intergenic
1065311625 10:24421906-24421928 ACGAAGACATAGAATAAGAAGGG - Intronic
1068351096 10:55846084-55846106 AGGGAGAAAGAGAATTTGAAGGG + Intergenic
1068403479 10:56560695-56560717 AGGGTGCCATAGACTTAGAATGG - Intergenic
1068824617 10:61421421-61421443 GGGTAGACATGGAATTTTAAGGG - Intronic
1068878162 10:62019859-62019881 AGGGAGCCACAGAATTAGCAAGG + Intronic
1070577276 10:77688577-77688599 GGGTAGAGACTGAATTAGAATGG + Intergenic
1071396077 10:85225441-85225463 GGGGAGGCAGAGAATGACAAAGG + Intergenic
1071664070 10:87536550-87536572 GGGTAGAAAGTGAATTAGAAAGG - Intronic
1071958878 10:90788488-90788510 TCGGAGACCAAGAATTAGAATGG + Intronic
1072664977 10:97386000-97386022 GGGGACACACAGGCTTAGAAAGG + Intronic
1073003474 10:100303049-100303071 GGGGAAAGAGAGAATGAGAAAGG + Intronic
1076070545 10:127484999-127485021 GGGGAGACAGGGAATGACAATGG - Intergenic
1077901805 11:6496186-6496208 GGGGAGAGAGAGAAAGAGAAAGG + Intronic
1078835813 11:15028262-15028284 GGGAAGTCATAGAATCATAATGG - Intronic
1081154863 11:39677499-39677521 GAGGAGACAGAGAAAGAGAAAGG + Intergenic
1081912343 11:46707829-46707851 GGGGTGACAAAGAATGGGAATGG + Intergenic
1082241180 11:49872567-49872589 GGGGTGACTTAGAAAAAGAATGG - Intergenic
1082631534 11:55548080-55548102 GAGGAGTCAGAGAATCAGAAAGG - Intergenic
1085520300 11:77134306-77134328 GGGGAGAGATAGAACTATAAAGG - Intronic
1085746676 11:79121084-79121106 GGGGAGACAGAGACTTAGAGAGG + Intronic
1085839488 11:79995096-79995118 GTGGACAAATGGAATTAGAAAGG - Intergenic
1086200751 11:84198717-84198739 GGGGAGACAAGGACTTAGAGAGG + Intronic
1087484116 11:98739580-98739602 GGAGAGAAATAGGCTTAGAACGG + Intergenic
1089841854 11:121425552-121425574 GAAGAGACAGAGAATTGGAATGG + Intergenic
1090448976 11:126789451-126789473 GGGGATACAGAGAAGTGGAATGG - Intronic
1092049833 12:5460578-5460600 TGGCACACATAGAACTAGAAAGG - Intronic
1092794628 12:12098007-12098029 GGGGAGACAAAGAATGTGAGAGG + Intronic
1093125730 12:15326097-15326119 GGGGAGACATAGGAAAGGAAAGG - Intronic
1093226584 12:16491381-16491403 GCCGAGACATAGAAAAAGAATGG + Intronic
1093715157 12:22373421-22373443 GAGGAGAGACAGGATTAGAAAGG + Intronic
1095490714 12:42731100-42731122 TGGGAGACACGGAATCAGAATGG - Intergenic
1095501381 12:42843242-42843264 GGGGAGAGAGAATATTAGAAAGG - Intergenic
1095747273 12:45673822-45673844 GGAGGGATATGGAATTAGAATGG - Intergenic
1100913583 12:99392335-99392357 GAGGAGAACTAAAATTAGAATGG - Intronic
1101094879 12:101327951-101327973 GGGGAAACTTAGGCTTAGAAAGG + Intronic
1101248870 12:102911682-102911704 GGGGACACATAGAAATTGTAAGG - Intronic
1102417306 12:112775069-112775091 GGGGAGGCAGAGTATTAGGAAGG + Intronic
1102671784 12:114625608-114625630 GAGGAGACAAAGGCTTAGAAAGG - Intergenic
1103037931 12:117671575-117671597 TGGAAGGCAAAGAATTAGAAGGG - Intronic
1103103621 12:118203394-118203416 GGTTAGACAGAGAATAAGAATGG + Intronic
1104452461 12:128881901-128881923 GGGGAGAAATGGAAATAGGACGG - Intronic
1105983617 13:25544502-25544524 GAGGAGAGATGGGATTAGAAGGG + Intronic
1107059376 13:36140083-36140105 GGGGAGAGGAAGAAGTAGAAGGG + Intergenic
1107252638 13:38382357-38382379 AGGGAAAAATAGGATTAGAAAGG + Intergenic
1107613547 13:42141027-42141049 GGGGAGGGATAGCATTAGGAGGG - Intronic
1107967730 13:45612793-45612815 AGGGAGGCATAGAATCAGAGAGG + Intronic
1109253004 13:60043453-60043475 AGGGAGGCAAAGAATGAGAAAGG + Intronic
1109895427 13:68681276-68681298 AGGCATATATAGAATTAGAAGGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113238303 13:108307174-108307196 AGGGAAAGATAGAACTAGAAAGG + Exonic
1113247767 13:108417589-108417611 GGGGAGTGAGAGTATTAGAAAGG + Intergenic
1113268730 13:108648893-108648915 AGAGAGAGAGAGAATTAGAATGG - Intronic
1113831964 13:113302822-113302844 GCGGAGACCTAGATCTAGAAGGG - Intronic
1117070074 14:52048308-52048330 GGGGAGACCTGGAGCTAGAACGG + Intronic
1118232409 14:63965402-63965424 GGGTAGACATGGGATTTGAATGG + Intronic
1118899927 14:69978087-69978109 GAGGAAACATGGAATAAGAATGG - Intronic
1119227364 14:72954587-72954609 GGGGAGAAAGAGCATCAGAAAGG + Intronic
1119753139 14:77094914-77094936 GGGGAGAACTTGAATTGGAAAGG + Intergenic
1120011651 14:79422580-79422602 TGGTAGAAATAGATTTAGAAAGG + Intronic
1120290612 14:82565520-82565542 AGGGAGGAATTGAATTAGAAAGG - Intergenic
1120436778 14:84492676-84492698 GGGGAGACATTGAAGTCAAAGGG - Intergenic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1121167945 14:91825432-91825454 GGGGATAAAAAGAATTTGAAAGG - Intronic
1125934171 15:43620240-43620262 GGGGAGATATAGATGGAGAATGG - Intergenic
1125947276 15:43719706-43719728 GGGGAGATATAGATGGAGAATGG - Intergenic
1126769625 15:52042246-52042268 GGGGAGAAAAAGATTTACAATGG - Intronic
1127304984 15:57696815-57696837 AGGGAGACAAAAAAGTAGAAGGG - Intronic
1128902823 15:71440818-71440840 GGGGACAGTTTGAATTAGAAGGG + Intronic
1129484718 15:75858935-75858957 AAGAAGACATAGGATTAGAATGG - Intronic
1129961163 15:79685987-79686009 GTGGTCTCATAGAATTAGAATGG - Intergenic
1130539081 15:84809004-84809026 GGGGAGACCTAGAATCAGTGGGG - Intergenic
1130577686 15:85106838-85106860 GGGGAGCCACAGAATCAGAGTGG + Intronic
1130943271 15:88529756-88529778 GGGGAGACATAGGTGTAGAAAGG + Intronic
1133187615 16:4111163-4111185 GGGCATCCATAGAATGAGAAGGG - Intronic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1134360426 16:13526101-13526123 TGGGAGACAGTGAATTAAAAGGG + Intergenic
1134388156 16:13793687-13793709 AGGCAGACATTGGATTAGAATGG - Intergenic
1139111008 16:63890865-63890887 GGGAAAAAATAGATTTAGAATGG - Intergenic
1140938404 16:79697556-79697578 GGAGAGAGAGAAAATTAGAAAGG - Intergenic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1145316185 17:21736294-21736316 GATGAGACATAGAATTGGCATGG + Intergenic
1145714615 17:27008222-27008244 GGTGAGACATAGAATTGGCATGG + Intergenic
1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG + Intronic
1146557931 17:33842618-33842640 GGAGAAACAGAGAATTAGGAAGG + Intronic
1148467118 17:47872009-47872031 AGGGAGACAGAGAAATAGATTGG - Intergenic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1149000019 17:51747851-51747873 GGGGAGGCATAGAAGAAGGAGGG - Intronic
1149228318 17:54501525-54501547 GGGGAAACTTAGGCTTAGAAAGG + Intergenic
1149509917 17:57231903-57231925 GAGGAGACTTAGGCTTAGAAAGG + Intergenic
1149963877 17:61142212-61142234 GAGGAGACAAAGACTTAAAAAGG + Intronic
1151439916 17:74121716-74121738 AGGGAGACAGAGAATGAGACAGG + Intergenic
1151527190 17:74678771-74678793 GGGGAGACAGAGAACAAAAACGG - Intronic
1152171037 17:78748829-78748851 GGGGTGATATATAATTAGTAAGG - Intronic
1155396285 18:25390087-25390109 GAGGAAACATAGAAAAAGAATGG + Intergenic
1155645343 18:28070763-28070785 GGGGAGACAAAGAGGTAGTAAGG + Intronic
1155900959 18:31389715-31389737 GGGCAGACATAGATTTGAAAGGG - Intronic
1159115221 18:64105908-64105930 ATGGAGAGATATAATTAGAAAGG + Intergenic
1159327880 18:66947686-66947708 CGGGAGAAAGAGTATTAGAAAGG + Intergenic
1160129580 18:76212858-76212880 GGGGAGAGAGAGGAATAGAAAGG - Intergenic
1160253208 18:77222145-77222167 GGGGAGGAATTGAATTAGAAAGG + Intergenic
1161501438 19:4618249-4618271 GGGGAAAGAGAGAATGAGAAAGG - Intergenic
1163154056 19:15430541-15430563 GGGGAGACAGAGAAGCAGATAGG - Intronic
1163358015 19:16827443-16827465 GGGGAGACATAGAAGGGGACTGG + Intergenic
1166215410 19:41331373-41331395 GGGGAGAGACAGAATAAGATAGG - Intronic
1167100907 19:47403732-47403754 AGGGAGACAGAGAATCAGAGTGG + Intronic
928207469 2:29296395-29296417 GGGGAGAAACAGAATCAAAACGG - Intronic
928249891 2:29666392-29666414 GTTGAGTCATAGAATAAGAAAGG + Intronic
929052394 2:37849128-37849150 GGGGAGATATTGAATGACAAGGG + Intergenic
929928104 2:46231773-46231795 GTGGAGACATAGAAAAAGACAGG - Intergenic
932206144 2:69884700-69884722 GGGGAAACAGAGTATTAGGATGG - Intergenic
932955120 2:76342996-76343018 GGGCAGAGATTGAATTAGAATGG - Intergenic
933753994 2:85623099-85623121 GGCAGGACATAGAATTTGAATGG + Intronic
934561865 2:95317693-95317715 GGGGAGTCCTAGAAAAAGAAAGG + Intronic
937649776 2:124307034-124307056 CGGGAGAAAGAGAATTAGATGGG - Intronic
938450220 2:131411743-131411765 GGTGAGAAAGAGAATTGGAAGGG - Intergenic
939176399 2:138753007-138753029 GGGGAAACATAAATTTATAATGG - Intronic
939186710 2:138869649-138869671 GGGGAGGGAGAGTATTAGAAAGG - Intergenic
939706455 2:145459190-145459212 AGGGATACATAGAAACAGAAAGG + Intergenic
940001538 2:148971146-148971168 GGGAAGGAACAGAATTAGAAGGG + Intronic
940264589 2:151823120-151823142 TGAGAGACATAGAATTAATAGGG - Intronic
940940304 2:159552179-159552201 AGGGAGTCAGAGAACTAGAATGG - Intronic
941310374 2:163921413-163921435 TGGGAGTAATAGAAGTAGAAAGG - Intergenic
942953830 2:181751240-181751262 GGGGAGACATACAAGTACACAGG - Intergenic
943398868 2:187378698-187378720 GTGAAGACATATAATAAGAAGGG - Intronic
944862963 2:203832556-203832578 GGGGAAACAAAGAACTAAAAAGG + Intergenic
945707913 2:213258675-213258697 GGGAAGACATGGAATTGTAATGG + Intergenic
946683087 2:222238543-222238565 GGGCAAACATAGAATTTAAATGG - Intronic
1169134545 20:3189387-3189409 GTGGAAACATAAAATTACAAAGG - Intergenic
1170115325 20:12851971-12851993 TGAAAGACATAGAATTAGCAGGG + Intergenic
1170179505 20:13513446-13513468 GGGGAGACAGAGAGGGAGAATGG + Intronic
1170273964 20:14562778-14562800 GGGGAAAGAAAGAATGAGAAAGG - Intronic
1170369175 20:15629989-15630011 GGGAAGAAAAAGAATGAGAACGG - Intronic
1170763317 20:19270762-19270784 GGAGAGAGATAGAGTTAGAGGGG + Intronic
1171384426 20:24759834-24759856 GGAGAAACAGAGAATTTGAATGG + Intergenic
1172630730 20:36376619-36376641 GGGGAGAGAGAGAGTTAGGAGGG + Intronic
1175432645 20:58917463-58917485 TGAGAGACCTAGAATTGGAAGGG + Intergenic
1177251218 21:18593716-18593738 GAGGTGAAATGGAATTAGAATGG + Intergenic
1177629450 21:23707420-23707442 GCAGAGAAATAGAATGAGAATGG - Intergenic
1178282865 21:31298573-31298595 GGGAAGACAGACAATTAGAGAGG - Intronic
1178436290 21:32561657-32561679 GGAGTGACTTTGAATTAGAATGG - Intergenic
1178663756 21:34528699-34528721 GGGGAGACAAAGAGTTGGAGAGG - Intronic
1179149560 21:38798337-38798359 GTGGAGACAGAGAATTATTAAGG + Intergenic
1179610999 21:42549972-42549994 GGGAAGGGATAGTATTAGAAGGG - Intronic
1181350168 22:22249501-22249523 GGGGAGAGAGAGAATCGGAAAGG - Intergenic
1181471671 22:23144309-23144331 GGGGAGACAAGGAAAGAGAACGG - Intronic
1182532877 22:30974670-30974692 GGGGAGACATAGGAAAGGAATGG + Intergenic
1182894880 22:33850820-33850842 AGGCAGGGATAGAATTAGAATGG - Intronic
1184817865 22:46885689-46885711 GGGAAGGCATAAAATTACAAGGG - Intronic
1184875540 22:47272626-47272648 GGAGGGAGATAGAATTAGGAAGG - Intergenic
949165286 3:933414-933436 TGGGAGGCTTAGAAATAGAAAGG - Intergenic
949879707 3:8651797-8651819 GGGGAGAAAGAGAATTAGGGTGG - Intronic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
953883229 3:46702064-46702086 GGGGAGACATAGCCTTAAGATGG + Intronic
954430957 3:50470639-50470661 GGGGAGACACAGGATTGGATGGG - Intronic
955771720 3:62391229-62391251 GGGAAGAAATGGAATAAGAACGG + Intergenic
955932377 3:64070404-64070426 GAGCAGACATAGAAAGAGAAAGG - Intergenic
955969916 3:64428416-64428438 CAAGAGAAATAGAATTAGAAGGG + Intronic
956638231 3:71388135-71388157 GGGAAGCCAGAGAATTAGATTGG - Intronic
959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG + Intronic
960729297 3:120707713-120707735 GGGGAGTAAAAGAATTACAAAGG + Intronic
960815613 3:121668806-121668828 GAGGAGACTGAGAATTAGTATGG - Intronic
960869040 3:122230831-122230853 GAGGGGACAGAGAAGTAGAAGGG - Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962219246 3:133549930-133549952 GAGGAAACAGAGACTTAGAAAGG + Intergenic
963311572 3:143715686-143715708 GGGGAGAGGAAGAATTAGAGAGG + Intronic
964074792 3:152680712-152680734 GGGGAGACATAACACTAGATGGG - Intergenic
965117593 3:164512225-164512247 GGGAAGACATGGAATTATAATGG - Intergenic
965482493 3:169236452-169236474 GGGGAGACATAAAACCAGATAGG + Intronic
967263547 3:187669963-187669985 GGGGAAAAAAAGAGTTAGAAGGG + Intronic
967440453 3:189501622-189501644 TGGAAGAAATGGAATTAGAAAGG + Intergenic
968756249 4:2417886-2417908 GGGGAGACGGAGAAGTAGTAGGG + Intronic
969083377 4:4637400-4637422 GTTGAGACATAAAATTACAAAGG + Intergenic
969320831 4:6411457-6411479 AGGGAGAAATGGAATTAGCACGG - Intronic
969918138 4:10510246-10510268 GGCTAGAAAGAGAATTAGAAGGG - Intronic
969974392 4:11083183-11083205 GAGGAGACAGAGACTCAGAATGG + Intergenic
970350935 4:15201252-15201274 GTGGAGATATAGAAGTAGATGGG + Intergenic
972032393 4:34477806-34477828 GGGGTGACAAAGAAGAAGAAGGG - Intergenic
973952667 4:56032981-56033003 TGGGATACATAAAATTACAAAGG - Exonic
975251703 4:72187051-72187073 AGGGAGACATAGAAAGAGAACGG - Intergenic
975611147 4:76204840-76204862 GAGGAGACATAGAAATAGGTAGG - Intronic
977872046 4:102103409-102103431 AGGAAGACAGAGAAGTAGAAGGG + Intergenic
977919233 4:102625286-102625308 GGGGAGAGAGAAAAGTAGAAGGG - Intergenic
978846726 4:113281881-113281903 GGGGAGATCTAGGATTTGAATGG + Intronic
978892445 4:113846517-113846539 TGGGAGACAGAGGATTATAAAGG + Intergenic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
981318984 4:143369819-143369841 GGGGAGACATACAATAGGCACGG - Intronic
982445800 4:155489486-155489508 GGGGAGACACAGTAGTAGGAAGG + Intergenic
983258855 4:165433192-165433214 AGGGAGACAGAGGAATAGAAAGG + Intronic
987198857 5:15554291-15554313 GGGGAGATATAGAGTGAGGAAGG - Intronic
987371511 5:17197781-17197803 AGAGAGACATAGAATCAAAAAGG - Intronic
988125276 5:27024886-27024908 TAGGAGACATAGAGTTAGCACGG + Intronic
989242821 5:39219897-39219919 GGGGATGCTTACAATTAGAAAGG + Intronic
989746277 5:44834033-44834055 GGAGAGACAATGAATGAGAAAGG - Intergenic
990136225 5:52646664-52646686 GGAGAGAGATAGAAGGAGAAAGG - Intergenic
990218033 5:53555760-53555782 GGGGTGAAATAGAATTAGTTTGG + Intergenic
991574500 5:68088768-68088790 GGGGAGAGAAAGAAGTATAAAGG + Intergenic
992322629 5:75628921-75628943 GGGGAGGGAGAGAAATAGAAAGG + Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993725977 5:91366897-91366919 GGGGAGTTGTAGAATGAGAAGGG - Intergenic
993995175 5:94713859-94713881 GGGCATACATAGAATTTGAAAGG - Intronic
996651535 5:125883153-125883175 GAGGAGGCATAGAAAGAGAATGG - Intergenic
997414278 5:133712904-133712926 GGGGAGAGAAAGAAGTAGGATGG - Intergenic
1000755759 5:165157562-165157584 GTGGAGACTGAGAAGTAGAAGGG - Intergenic
1002818827 6:703431-703453 GGGGAGGTGTAGAAGTAGAAAGG - Intergenic
1004013781 6:11713625-11713647 GGGAAGTGATAGAATTATAAGGG - Intronic
1004494305 6:16149346-16149368 GTGGCATCATAGAATTAGAAGGG + Intergenic
1006968422 6:38014092-38014114 GGAGAGAGAGAGAATGAGAATGG + Intronic
1007053441 6:38857003-38857025 AGGGAGACAGAAAATGAGAAGGG - Intronic
1007464945 6:42045140-42045162 GGAGAGGGATAGAATTGGAAGGG - Intronic
1007907470 6:45476814-45476836 AGGGAAAGATAGATTTAGAAGGG - Intronic
1009900494 6:69803010-69803032 AGGAAGACACAGAATTTGAAGGG + Intergenic
1011207811 6:84919476-84919498 GAGGAGAGAGAGATTTAGAAAGG + Intergenic
1013982556 6:116149651-116149673 GTGGAGACACTGAATTAAAAAGG + Intronic
1014558944 6:122867329-122867351 GGAGAGACATACAATGATAAAGG - Intergenic
1014656839 6:124117063-124117085 GGGAAGGCAAATAATTAGAAAGG - Intronic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1015063357 6:128995642-128995664 GGGGAGAGAGAGAAGGAGAAAGG - Intronic
1015373684 6:132485522-132485544 GTGGATAAATAGAAGTAGAACGG + Intronic
1016064280 6:139662854-139662876 CTTGAGACACAGAATTAGAAGGG + Intergenic
1017805716 6:157943763-157943785 GAGGAGCCAAAGAATAAGAAAGG - Exonic
1019528110 7:1489886-1489908 TGGGAAACAGAGACTTAGAAAGG - Intronic
1019704372 7:2490415-2490437 GGGGAGACAGAGACTTAGGGAGG + Intergenic
1020515822 7:9117691-9117713 GAGGAGACAAAGGATAAGAAAGG + Intergenic
1021634570 7:22679109-22679131 GGAGAGAGAAAGAACTAGAAAGG + Intergenic
1023996830 7:45163700-45163722 GGGGAGACAAAGGACCAGAAAGG + Intronic
1025868571 7:65408541-65408563 AGGGAGAAATAGAATTACCAGGG + Intergenic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1028730301 7:94140039-94140061 GGAGAGAAATGGAATTAGAAGGG - Intergenic
1028819951 7:95197485-95197507 GGGGAAAGATAGTATGAGAAGGG - Intronic
1029664152 7:101983679-101983701 GGGGAGAGAGAGAGTGAGAAGGG + Intronic
1029915113 7:104201041-104201063 GGTGGGATATAGATTTAGAAAGG - Intronic
1031366728 7:120909761-120909783 TAGGAGACAGAGAATTAAAATGG + Intergenic
1031526332 7:122825454-122825476 AGGGAGAGATAAAATTAAAATGG + Intronic
1031741258 7:125434391-125434413 GGGGAAAAATAGAAGGAGAAAGG - Intergenic
1033997505 7:147369309-147369331 GGGGAGACAGAGAATGAGTTTGG - Intronic
1036688508 8:10926973-10926995 GGAGAGACACAGAAGTAGGAGGG + Intronic
1037180027 8:15994351-15994373 GTGGAGCCATAAAATTATAATGG - Intergenic
1037422894 8:18722800-18722822 TGGGAGTGATAGAATTTGAATGG - Intronic
1039471956 8:37818977-37818999 GGGGAGTCTGAGAAATAGAAGGG + Intronic
1040945108 8:52875960-52875982 GGAAATACATAGAATTATAAAGG + Intergenic
1040949146 8:52918601-52918623 GGGGAGAGAGAGATGTAGAAAGG + Intergenic
1041800818 8:61796198-61796220 GGGAAGAAATAGAGTTAGACTGG - Intergenic
1042686585 8:71448429-71448451 GAAGAGAAATAGAATTAGAGTGG - Intronic
1042820330 8:72923283-72923305 GGGGAGACCTAGAAATGGAAAGG + Intronic
1043540776 8:81259879-81259901 GAGGAGTCATAAAATTGGAAGGG + Intergenic
1043644040 8:82494805-82494827 GGGTAGACATACAATTATATTGG - Intergenic
1045409713 8:101904643-101904665 GGAGAGAGATAGAATTGTAAAGG - Intronic
1046106277 8:109670882-109670904 AGGTAGAAATAGAGTTAGAATGG + Intronic
1046933636 8:119865862-119865884 AAGGAGACATTGAATTAGATGGG - Intergenic
1047338676 8:123959201-123959223 GGTGAGACATCGAGGTAGAAAGG - Intronic
1047509551 8:125505917-125505939 GGGGAAACATAGAAAGAGGAAGG + Intergenic
1050037286 9:1450577-1450599 GGGGAGGGAGAGTATTAGAAAGG - Intergenic
1050851580 9:10293824-10293846 GGTGAGACATGGAGTTAGATAGG + Intronic
1051336975 9:16074552-16074574 GGGGAGATAGAGAATTAAATAGG + Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1054340309 9:63854681-63854703 TGGGTGTCATAAAATTAGAAGGG - Intergenic
1055600865 9:77917057-77917079 GAGGAGATAAAGAATTATAAAGG + Intronic
1058079781 9:100689715-100689737 GGGGAGGCAGAGAATGAAAATGG + Intergenic
1058484335 9:105428537-105428559 GGGGAAACTGAGAATTAGATGGG - Intronic
1059754755 9:117282126-117282148 GGAGAGACATAGAAAAATAAAGG - Intronic
1061453012 9:130678699-130678721 GGGGAGAGAGAGAATGAGAGAGG + Intronic
1186004213 X:5050422-5050444 AGGTAGCCATAGAAATAGAATGG - Intergenic
1187559474 X:20388355-20388377 GGGGATAGATAGAATTGGATAGG + Intergenic
1189565638 X:42238350-42238372 GGGTAGACAGAGAATTTGAGTGG + Intergenic
1189906790 X:45769502-45769524 GGAGAAACATAAAATCAGAATGG - Intergenic
1191663033 X:63670081-63670103 GGGGTGAATTAGAATTAGAATGG - Intronic
1191942999 X:66499951-66499973 GGGGAGAAATGGAAGGAGAAGGG - Intergenic
1194740072 X:97562182-97562204 GAGGAGACTGAGAATTAGAAAGG + Intronic
1195629000 X:107034182-107034204 GGAGACACCTAGAATTTGAAAGG + Intergenic
1197176441 X:123491155-123491177 GAGGAGACAAAGAATGGGAATGG - Intergenic
1197771895 X:130094615-130094637 GGGGGGACATAGAGTGAGAGGGG - Intronic
1198551063 X:137745297-137745319 GGATAGAGATAAAATTAGAAGGG - Intergenic
1198757405 X:139995856-139995878 AGGGAGAGGTAGATTTAGAATGG + Intergenic
1200328339 X:155265853-155265875 GGGGAGGGATAGCATTAGGAGGG + Intergenic