ID: 959651524

View in Genome Browser
Species Human (GRCh38)
Location 3:108755699-108755721
Sequence TTTGAGTTAGATTTCTTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959651519_959651524 13 Left 959651519 3:108755663-108755685 CCCAAGAATCAGGAATGGAACAA 0: 1
1: 0
2: 0
3: 23
4: 265
Right 959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG 0: 1
1: 1
2: 4
3: 19
4: 264
959651520_959651524 12 Left 959651520 3:108755664-108755686 CCAAGAATCAGGAATGGAACAAA 0: 1
1: 0
2: 3
3: 38
4: 308
Right 959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG 0: 1
1: 1
2: 4
3: 19
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959651524 Original CRISPR TTTGAGTTAGATTTCTTGGT TGG Exonic