ID: 959651524

View in Genome Browser
Species Human (GRCh38)
Location 3:108755699-108755721
Sequence TTTGAGTTAGATTTCTTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959651520_959651524 12 Left 959651520 3:108755664-108755686 CCAAGAATCAGGAATGGAACAAA 0: 1
1: 0
2: 3
3: 38
4: 308
Right 959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG 0: 1
1: 1
2: 4
3: 19
4: 264
959651519_959651524 13 Left 959651519 3:108755663-108755685 CCCAAGAATCAGGAATGGAACAA 0: 1
1: 0
2: 0
3: 23
4: 265
Right 959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG 0: 1
1: 1
2: 4
3: 19
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959651524 Original CRISPR TTTGAGTTAGATTTCTTGGT TGG Exonic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905517333 1:38571497-38571519 TTTGAGCTAGATTTTATTGTTGG - Intergenic
905725504 1:40247814-40247836 TTTGAGTAAGATTCATTGGTTGG + Intronic
909071324 1:70996973-70996995 TTTGAAGTATATTTCTTGGCTGG + Intronic
910011389 1:82467860-82467882 TTTTAGTTTTATTTCTTGTTTGG + Intergenic
910079483 1:83324405-83324427 TTTGATTTTCATTTCTTTGTGGG + Intergenic
913417132 1:118620985-118621007 CTTGAGTAAGAGATCTTGGTTGG + Intergenic
918573822 1:186031467-186031489 TTTGGTTTTGATGTCTTGGTGGG + Intronic
918810227 1:189108534-189108556 TTAGAGTCAGAGATCTTGGTTGG + Intergenic
918881022 1:190121148-190121170 TTTGTGTTAGATTTAGTGGGAGG - Intronic
920566103 1:206974666-206974688 TTTGGGTGGGATTTCTTGGCAGG + Intergenic
920881592 1:209885919-209885941 TCTGGGTTAGTTTTCTTGCTTGG + Intergenic
921173479 1:212570430-212570452 TTTGAGTTTTATATCTTGCTAGG - Intronic
923234333 1:232018099-232018121 TTTAAGTTAAATTGCTAGGTAGG - Intronic
1064274379 10:13892503-13892525 ATTGAGTTATTGTTCTTGGTGGG - Intronic
1064980435 10:21161345-21161367 ATTGAGTCAGCTTTCTTGGCTGG + Intronic
1065621924 10:27590814-27590836 CCTGAGTTAGTTTTTTTGGTTGG - Intergenic
1067493078 10:46732145-46732167 TTTGAGATAAATTTATTTGTTGG + Intergenic
1067601585 10:47608262-47608284 TTTGAGATAAATTTATTTGTTGG - Intergenic
1068732216 10:60372136-60372158 TTTTAGTTTTATCTCTTGGTTGG - Intronic
1070071586 10:73095922-73095944 TTTGAGTTGGATTACATGGCTGG - Intronic
1071653109 10:87415843-87415865 TTTGAGATAAATTTATTTGTTGG - Intergenic
1075231769 10:120686086-120686108 TTTGTGTTATTTTTCTAGGTAGG + Intergenic
1075552787 10:123405215-123405237 TTTGTATTAGATTTCTTTCTGGG + Intergenic
1078033377 11:7776682-7776704 CTTGATTTCGTTTTCTTGGTGGG - Intergenic
1078916670 11:15784725-15784747 TTTGAGTTATCTTTTTTGGCTGG - Intergenic
1080420192 11:32103154-32103176 TTTGAGTTAGGTCTCTGGATTGG + Intronic
1081291283 11:41328578-41328600 CTTGAGTTAGTTCTCTTCGTAGG + Intronic
1085904589 11:80745101-80745123 ATTGAGTATGCTTTCTTGGTGGG - Intergenic
1086393553 11:86390722-86390744 TATGACTCAGATTTCTTGGTTGG + Intronic
1088284946 11:108178301-108178323 TTTGAGTTAGATTTCTTGCTGGG + Intronic
1088447911 11:109952036-109952058 TTTGAGTTCGATTCATTTGTTGG - Intergenic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1090916785 11:131171635-131171657 TTTGAGTTATTTTTTATGGTTGG + Intergenic
1093569334 12:20648384-20648406 TTTTCTTTAGATTTCTTTGTAGG - Intronic
1094683631 12:32688338-32688360 TTTAAGTTAGAATTTTTGATGGG + Intronic
1095435797 12:42186335-42186357 TTTGAGTTGGAGTTTTTGCTCGG - Intronic
1095593773 12:43936402-43936424 ACTGAGTTTGATTTCCTGGTAGG + Intronic
1095602911 12:44034616-44034638 TTTGAGTTTGATTTATTGAGTGG - Intronic
1097488042 12:60230881-60230903 TTTAAGATATATTTCTTGGTCGG - Intergenic
1098516574 12:71384075-71384097 TTTTAGTTACAGTTCCTGGTTGG - Intronic
1099738005 12:86595800-86595822 TCTGACTTAGACTTATTGGTGGG + Intronic
1100042349 12:90335674-90335696 TTTGGCCTAGAATTCTTGGTTGG + Intergenic
1100447205 12:94671964-94671986 TTTATATTGGATTTCTTGGTTGG + Intergenic
1103855640 12:123968513-123968535 TTAAAGTTTTATTTCTTGGTTGG + Intronic
1106556624 13:30814632-30814654 TTTGAGTTAGCTTTTGTGGAAGG + Intergenic
1109390818 13:61690281-61690303 TTTGAGTTAATTTTCTTGAGTGG - Intergenic
1109630584 13:65040197-65040219 TGTGAATTAGATTTTGTGGTGGG - Intergenic
1109808821 13:67480801-67480823 TTTGATTTGCATTTCTTGGATGG + Intergenic
1111038351 13:82708693-82708715 TTTAAGTTAGATTTCTTCCCTGG - Intergenic
1111159781 13:84379288-84379310 TTGGAGTTCTTTTTCTTGGTAGG - Intergenic
1111297665 13:86304147-86304169 TTTGAGGTATATTTATTGGGAGG - Intergenic
1111578592 13:90192020-90192042 TTAAATTTAGATTTCTGGGTTGG + Intergenic
1111746598 13:92278688-92278710 TTTGAGTTAAATTTTGTGTTGGG + Intronic
1111938825 13:94587058-94587080 TAAGAGTTTGATTTCTTGCTGGG - Intronic
1113043827 13:106132576-106132598 TTGGAGTTAGGTCTCATGGTTGG - Intergenic
1116155427 14:41197670-41197692 TTTGATTTACATTTCTTTGATGG - Intergenic
1117464494 14:55978684-55978706 TTTGAGTTTTTTTTCTGGGTAGG - Intergenic
1117816202 14:59600596-59600618 TTTGAAGGAAATTTCTTGGTGGG - Intronic
1118225639 14:63896537-63896559 TTTGGGTTAGATTCCTTGGCAGG + Intronic
1118486254 14:66216630-66216652 GTTCAGTTAGACTTCTTGCTAGG - Intergenic
1118943635 14:70362028-70362050 TTTGAGTCATATTTCTGGGAAGG - Intronic
1119001065 14:70882488-70882510 CTGGAGTTAGATTTCTTGGGTGG - Intergenic
1120263695 14:82221496-82221518 TTTGTGTTAGATTTTTTTTTTGG - Intergenic
1120285505 14:82495487-82495509 CTTCAGTTAAATTTGTTGGTAGG - Intergenic
1120513106 14:85439072-85439094 TATGAGTTAGATTTCTATGCAGG + Intergenic
1121721798 14:96114530-96114552 GCTCAGTTAGATTTCTTGCTAGG + Intergenic
1122712040 14:103666043-103666065 TTTGAATTTGAGTTCTTGGTGGG + Intronic
1123423756 15:20151963-20151985 TTTGGGTTACATTTCTTAGGAGG + Intergenic
1123532978 15:21158484-21158506 TTTGGGTTACATTTCTTAGGAGG + Intergenic
1124556697 15:30732534-30732556 TTTAGGATAGATTTCTTGGGAGG + Intronic
1124674581 15:31673203-31673225 TTTAGGATAGATTTCTTGGGAGG - Intronic
1124974063 15:34516992-34517014 TTGGAGAAAGATTTCTTGGGAGG + Intergenic
1126405417 15:48317864-48317886 TTTGAGATGGAGTTCTTGTTCGG - Intergenic
1127536593 15:59895476-59895498 TTGGAGGTGGATTTCTTGCTAGG + Intergenic
1127663423 15:61121389-61121411 CTTGAGTTAGATATGGTGGTGGG - Intronic
1127876027 15:63112214-63112236 TTTTAGTTAGATTTCTCTGTGGG - Intergenic
1128891849 15:71338645-71338667 TTTGAGTTAGTTCTGTTGTTTGG + Intronic
1129886729 15:79043385-79043407 TTTGATTTTGATTTCTTGCAGGG + Intronic
1130509028 15:84573027-84573049 TTGGAGAAAGATTTCTTGGGAGG + Intergenic
1132186208 15:99804091-99804113 TTGGAGAAAGATTTCTTGGGAGG - Intergenic
1132306596 15:100819416-100819438 TTTGGGACAGATTTCATGGTGGG - Intergenic
1134824755 16:17275577-17275599 TTTGAGATTCATTTCTAGGTTGG + Intronic
1135155655 16:20050694-20050716 TTTGAGTTGGATCTGTTGGGAGG + Intronic
1136861068 16:33703642-33703664 TTTGGGTTACATTTCTTAGGAGG - Intergenic
1138718580 16:59052528-59052550 TTTGAATTAGAATGCTTGCTGGG + Intergenic
1141374312 16:83516006-83516028 TTTGAATTGATTTTCTTGGTTGG - Intronic
1203122564 16_KI270728v1_random:1551832-1551854 TTTGGGTTACATTTCTTAGGAGG - Intergenic
1144245901 17:13364303-13364325 TTCAAGTTAGATTTCCTGTTGGG + Intergenic
1144609083 17:16693166-16693188 GATAGGTTAGATTTCTTGGTAGG + Intronic
1144903679 17:18622360-18622382 GATAGGTTAGATTTCTTGGTAGG - Intergenic
1145128899 17:20324370-20324392 GATAGGTTAGATTTCTTGGTAGG + Intergenic
1145195771 17:20893253-20893275 GATAGGTTAGATTTCTTGGTAGG - Intronic
1145925423 17:28643395-28643417 TTTGAGCTATATTTCTAGGAAGG - Intronic
1147876953 17:43628486-43628508 TTTGAGTTGGGTTTCTCGGCAGG + Intergenic
1148764792 17:50031278-50031300 TTTGGGTTAGATTTATTTTTAGG - Intergenic
1150517574 17:65830184-65830206 TTTTAGTTATATTTTTTGGCAGG - Intronic
1150831882 17:68529207-68529229 TTTGAGTCAGAATTCTTGAAGGG + Intronic
1151692303 17:75694090-75694112 TCTGAGTCAGAGCTCTTGGTGGG + Intronic
1155003969 18:21711601-21711623 TTAGAGTTAGATTGCTGGGGTGG - Intronic
1155152159 18:23131743-23131765 TCTGAGTTAGTTTTCTCTGTGGG - Intergenic
1155844662 18:30690653-30690675 TTTGATTTAGATTGCTTTCTAGG + Intergenic
1156357612 18:36355821-36355843 TTTGAGTAACTTTTCTTGATGGG + Intronic
1157037365 18:43991103-43991125 TTTGAGTTATATTTCTCTGGTGG + Intergenic
1158750544 18:60254209-60254231 TGTTAGTTAGAAGTCTTGGTTGG - Intergenic
1159986924 18:74853752-74853774 TTTGAGGTAGATTGCTGGGTGGG - Intronic
1159998265 18:74989543-74989565 TTGGAATTACATTTCTTGGCTGG + Intronic
1167568796 19:50273938-50273960 TTTGAGTCTGACTTCTGGGTTGG + Intronic
925421317 2:3714642-3714664 TTTGAGTTAGATTCATTGGTAGG - Intronic
925928704 2:8689488-8689510 TTTGGGATAGATTTCTAGGAGGG - Intergenic
927189460 2:20507239-20507261 TTTGATTTACATTTCCTGGACGG - Intergenic
928415056 2:31085197-31085219 TTCGAGTCAGATTTCTAGTTAGG - Intronic
929088634 2:38193236-38193258 TTTGAGGTTGATTTTGTGGTCGG + Intergenic
929317709 2:40500199-40500221 TTTTAATTAGATTGCTGGGTAGG - Intronic
929929714 2:46243773-46243795 TTTAATTTACATTTCATGGTGGG + Intergenic
930194649 2:48497026-48497048 TTTGAGTTTGATTAATTTGTTGG - Intronic
930225107 2:48784228-48784250 TTTGAGTTAGCTTTTGTGGATGG + Intergenic
931007762 2:57871829-57871851 TTTGAGTCATATTTTTTTGTGGG - Intergenic
931891370 2:66676199-66676221 TTTAAGTGAGATTTCTAGTTTGG + Intergenic
933041245 2:77469394-77469416 TTTCAGTTTGAATTCTTTGTAGG - Intronic
934914561 2:98290532-98290554 TTTGATTTGGTTTTCTTTGTTGG - Exonic
935549665 2:104439252-104439274 TTAGAGTTATATTGCATGGTAGG - Intergenic
936508297 2:113125622-113125644 TTTGATTCTGATTTGTTGGTTGG + Intronic
937343885 2:121110728-121110750 TTTGAATGAGATTTCTGGATTGG + Intergenic
937792395 2:125976078-125976100 TTTGAATTAGTTTTTTTGGGGGG + Intergenic
938817047 2:134915577-134915599 TTTGAGTTAAATTTTGTGGAAGG + Intergenic
939132417 2:138252819-138252841 TTTGTGTTAGTTTTCTAGGGCGG - Intergenic
939299391 2:140315645-140315667 TATAAGGAAGATTTCTTGGTTGG - Intronic
940155817 2:150655844-150655866 TTGGAGTTAGATTGCTTGGTGGG - Intergenic
940738336 2:157479285-157479307 TTTAATTTACATTTCCTGGTAGG + Intronic
941723604 2:168837900-168837922 TTTAAATTAGATTTCTTTATGGG + Intronic
941829626 2:169940411-169940433 TTTGAGTTATATTTTTAAGTTGG + Intronic
941995003 2:171594030-171594052 TTTGACTTAGATTTATTGGTGGG - Intergenic
942294395 2:174503855-174503877 TCTGACTTAGATTTATTGCTGGG - Intergenic
943532819 2:189107436-189107458 TTTAGGTTAGATCTTTTGGTTGG + Intronic
943915203 2:193622914-193622936 TTTGATTTGCATTTCTTGGATGG + Intergenic
944123723 2:196269905-196269927 CTTGAATTAAATTTCTGGGTAGG + Intronic
945769858 2:214029672-214029694 TTTGAGTAAGATTTGTTTTTGGG - Intronic
946508191 2:220324286-220324308 ATGGAGTTAGAGTTCTTGCTTGG + Intergenic
947679074 2:232013041-232013063 GTTGTGTGAGATTTCTAGGTAGG - Intronic
947707169 2:232285643-232285665 TTTGAGTTCCATTTCCAGGTTGG + Intronic
1169571257 20:6908590-6908612 TTTGAATGAGTTCTCTTGGTTGG + Intergenic
1170051375 20:12149421-12149443 TTAGAGCTAGATTTCATGGGTGG - Intergenic
1170593737 20:17790398-17790420 CTTGAGGTAGAATTCTTGTTTGG - Intergenic
1173776788 20:45715007-45715029 TTTGAGTGGGGTTTTTTGGTGGG - Intergenic
1174234745 20:49080153-49080175 TTAGACTTAGATTCCTTGGTCGG + Intronic
1178364338 21:31976195-31976217 TTTGAGTTAGATTTCACAGATGG + Intronic
1178775320 21:35544622-35544644 CTTGAGTTTGATTTGTTTGTAGG - Intronic
1179456661 21:41505387-41505409 TTTGGTTTACATTTCCTGGTAGG + Intronic
1181356765 22:22301684-22301706 TTTGGGTTACATTTCTTAGGAGG + Intergenic
1182541077 22:31042433-31042455 TTTATGTCAAATTTCTTGGTGGG + Intergenic
1182815557 22:33160236-33160258 TTTGAATTACATTTTTTGTTTGG + Intergenic
950635802 3:14313688-14313710 TTTGAGCTGGACTTCTTGTTGGG - Intergenic
955790604 3:62585229-62585251 TTTGATTTTGAGATCTTGGTCGG + Exonic
956259300 3:67320104-67320126 TTTGACTTAGCTATCTTAGTGGG + Intergenic
957417606 3:79926959-79926981 TCTGAGTAAGATATTTTGGTGGG + Intergenic
959165961 3:102778476-102778498 ATTGAGTTAGATTTTTTGTTTGG + Intergenic
959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG + Exonic
962016844 3:131449641-131449663 TTTGAGTTTGTTGACTTGGTAGG + Intergenic
962808668 3:138944680-138944702 TTTGCGTTAGAGTTTTTGTTGGG - Exonic
963915215 3:150853210-150853232 TTTGAGTTAGATTTTGTGTACGG + Intergenic
964117174 3:153148455-153148477 TTTCAGTTACATTTCTTGGCTGG - Intergenic
964122792 3:153203742-153203764 ATGGGGTTGGATTTCTTGGTTGG - Intergenic
964541439 3:157783772-157783794 TTTGAGTTTGTTTGCTTGTTTGG - Intergenic
965114671 3:164473086-164473108 TTTGAGTTAATTTTTGTGGTGGG + Intergenic
967119970 3:186374091-186374113 AGTCAGTGAGATTTCTTGGTAGG + Intergenic
967779817 3:193424654-193424676 TTTGAGTTAATTTTCTTATTTGG - Intronic
968095446 3:195926971-195926993 TTTGAGTTAGTTTTTGTGGATGG + Intergenic
968635861 4:1678849-1678871 TTTGAGTTAGTTTTCATGAAGGG - Intronic
970268755 4:14319684-14319706 TTTGAGGTAGAATTCATGCTGGG - Intergenic
971881610 4:32382173-32382195 TTTAACTTAAAATTCTTGGTGGG + Intergenic
971987169 4:33840867-33840889 GTTGAGTCAGATGTCTTGTTAGG + Intergenic
972158247 4:36191818-36191840 GGTGAGTTAGATTTCTTTGCAGG + Intronic
974452095 4:62078014-62078036 TTTGAATTAGATTTAATGCTTGG - Intronic
975370366 4:73578950-73578972 ATTGAGATAGATTACCTGGTGGG - Intronic
977259074 4:94776362-94776384 TTTGAGACAGCTTTCTTGATTGG + Intronic
977630427 4:99236757-99236779 TTTGATTTACATTTCTTTTTTGG + Intergenic
977785396 4:101027569-101027591 ATTGAGTTAGTTTTCAGGGTGGG - Intronic
978826797 4:113034145-113034167 TTTGAGATAGGATTCTTGATAGG + Intronic
979167261 4:117551039-117551061 TTTGTGTTTGATTTCTTGCAGGG + Intergenic
979769286 4:124502762-124502784 TTTGAATAATATTTTTTGGTGGG + Intergenic
980236959 4:130120775-130120797 TCTGAGTTATTTTTCTTGGAAGG - Intergenic
980747982 4:137045969-137045991 TTTCTGTTTGATTTCTTTGTTGG + Intergenic
980907995 4:138967805-138967827 TTTGATTTATATTTCTTGAAAGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981728459 4:147872394-147872416 GTAGAATTAGATTTCTTGGTAGG + Intronic
982228777 4:153189259-153189281 TTTGGATTAGATTTCCTGCTTGG - Intronic
983046713 4:162995972-162995994 TTGGAGTTAGATTTCAGGATTGG - Intergenic
984469712 4:180152702-180152724 ATTCATTTAGATTTCTTGGAAGG - Intergenic
986713812 5:10507867-10507889 TTTGAGTGAGCCTCCTTGGTTGG + Intronic
987301531 5:16601987-16602009 CTTGATTTAGAGTTCTGGGTTGG - Intronic
988309107 5:29534494-29534516 TTTGAGGTATATTTCTTTGATGG + Intergenic
988659332 5:33247454-33247476 TTTGAGTTAGTTTCCCAGGTAGG - Intergenic
989982326 5:50659351-50659373 TTTGAGTTTGTTTAGTTGGTTGG - Intergenic
991084044 5:62632130-62632152 TTTGATCTTGATATCTTGGTAGG + Intergenic
991939921 5:71840691-71840713 TTTAAGTTATATTTCCTAGTTGG + Intergenic
995791299 5:115891175-115891197 TTTTAGTTTAATTTTTTGGTAGG - Intronic
997918403 5:137952259-137952281 TTTCATTAAGATTTTTTGGTAGG - Intronic
1000942412 5:167378051-167378073 TTTTAATTTCATTTCTTGGTGGG + Intronic
1001501579 5:172240469-172240491 TTTGAGGTAGCTTTATTGGGGGG + Intronic
1002580635 5:180207953-180207975 TTTGCCTTTGATTTCTTGTTTGG + Intronic
1003043957 6:2715617-2715639 TTTGATTTAGATGTCTTGTAGGG - Intronic
1005891096 6:30139063-30139085 TTTGTGTTAGATGTCATGCTAGG + Intronic
1009380612 6:63024180-63024202 CTTGAGATATATGTCTTGGTTGG + Intergenic
1009634776 6:66251415-66251437 TTTGAGTTTTATTTCATTGTGGG - Intergenic
1009732444 6:67626480-67626502 TTTGAAAGAAATTTCTTGGTGGG + Intergenic
1009957669 6:70474733-70474755 TTTGAGTGAGCTTCCCTGGTTGG - Intronic
1010278503 6:73996627-73996649 GGTGTGTTAGATTTATTGGTTGG - Intergenic
1010480474 6:76346507-76346529 GTTGAATTAGAATTCTTTGTTGG - Intergenic
1011445955 6:87440174-87440196 TTTTGGTTAGATTTATTTGTAGG + Intronic
1011739124 6:90341946-90341968 TTGGAGACAGATTTCTGGGTTGG + Intergenic
1013387878 6:109650497-109650519 TTTGATTTGCATTTCTTGGACGG - Intronic
1013389408 6:109668125-109668147 TTTGATTTGCATTTCTTGGACGG + Intronic
1013393969 6:109715289-109715311 TTTCCGTTATTTTTCTTGGTTGG + Intronic
1017152916 6:151297141-151297163 TTTGAGTTACATTGATGGGTGGG + Intronic
1017706372 6:157127131-157127153 CTTGATTTAGATTTCTTCCTAGG + Intronic
1021556526 7:21924587-21924609 TTTGAGTTAGTTCTTGTGGTTGG - Intronic
1021612148 7:22467836-22467858 TTTGAACTATATCTCTTGGTAGG - Intronic
1021641933 7:22746229-22746251 TTTGACTTAGATTTATTGCTGGG - Intergenic
1022122135 7:27318959-27318981 TATGACATAGAATTCTTGGTTGG + Intergenic
1022196956 7:28077946-28077968 TTTGAGCTAGATTACATAGTGGG - Intronic
1022433284 7:30349972-30349994 TCTTAGTTTGATTTCATGGTTGG + Intronic
1022688981 7:32627077-32627099 TTTGAGTTAGTTTTCATGAAGGG - Intergenic
1022916560 7:34961477-34961499 TTTGAGTTAGTTTTCATGAAGGG - Intronic
1026057610 7:66997940-66997962 TTTAAATTAGATTTCTTAGCTGG + Intronic
1026720501 7:72827092-72827114 TTTAAATTAGATTTCTTAGCTGG - Intronic
1027297242 7:76789693-76789715 TTTGATTTTCATTTCTTTGTGGG + Intergenic
1030180128 7:106698441-106698463 TTTGAGTTAAATTTCTGTGAAGG + Intergenic
1030353371 7:108516431-108516453 TTTGAGTTAATTTTTTTGATAGG - Intronic
1030862733 7:114657005-114657027 TTAGAATTAGTTTTCTTGCTTGG + Intronic
1031843357 7:126773828-126773850 TTTTAGTTTTATTTTTTGGTAGG - Intronic
1033098355 7:138449887-138449909 TTTGAGTTATATTTCTTTTTTGG - Intergenic
1033570488 7:142623607-142623629 TTTGAGTTATGTTTCTTGCTTGG + Intergenic
1036684072 8:10897335-10897357 TTTGTGTTGTATTTGTTGGTTGG + Exonic
1036700516 8:11010581-11010603 TCAAAGATAGATTTCTTGGTTGG - Intronic
1037066477 8:14584372-14584394 TTTGGGTTAGAGATCTTGGAGGG + Intronic
1038890981 8:31723154-31723176 ATTGAGTATGATTTCTTGCTGGG + Intronic
1039816448 8:41098771-41098793 TTTCAATTATATATCTTGGTGGG + Intergenic
1040441183 8:47444286-47444308 CTGGAGTTAGATTTCATGGCAGG - Intronic
1041428317 8:57748793-57748815 GATGATTTAGTTTTCTTGGTGGG + Intergenic
1042482238 8:69317334-69317356 TTGGAGATAGATTTGTTGGCAGG + Intergenic
1042501139 8:69510588-69510610 TTTGTGTTGGGTTTTTTGGTGGG + Intronic
1043751541 8:83942826-83942848 TTTGAGTGGGATTTGTTGCTGGG + Intergenic
1044667570 8:94646485-94646507 TTGGAGATGGATTTTTTGGTGGG + Intronic
1046010506 8:108540791-108540813 TTTCAGGTGGATTTCTTTGTGGG + Intergenic
1046184948 8:110700807-110700829 TTTAAATTAGAATTCTTGGAAGG + Intergenic
1047037829 8:120958785-120958807 TTTGATTTAGGTTTTGTGGTAGG + Intergenic
1048091161 8:131241711-131241733 TTTGAGTTAGATTTCTGTCATGG - Intergenic
1048545040 8:135378789-135378811 ATTGAGTAAGATTTCTTATTAGG - Intergenic
1048801145 8:138194712-138194734 CTTGTGTTAGATATCTGGGTGGG - Intronic
1050260036 9:3831387-3831409 TTTGATTTGTATTTCTTTGTGGG - Intronic
1050501882 9:6307051-6307073 TTTGAGTTTGAGCTCTTGGCAGG + Intergenic
1051146580 9:14033452-14033474 GTGGAGTTAGATTTGTTGTTAGG + Intergenic
1051898939 9:22017866-22017888 CTTGAGTTAGATATGTTGATGGG + Intronic
1052283495 9:26758586-26758608 AATGAGTTTGATTTCTTGGTGGG + Intergenic
1053689941 9:40580589-40580611 TTTGGGTTACATTTCTTAGGAGG - Intergenic
1054301189 9:63381533-63381555 TTTGGGTTACATTTCTTAGGAGG - Intergenic
1056376168 9:86013910-86013932 TTTGAGTTAAAATTGGTGGTGGG + Intronic
1058048076 9:100378729-100378751 TTTGATTTTTATTTTTTGGTGGG - Intergenic
1058254311 9:102742435-102742457 TTTGAGTTAGATTTTATGAAAGG + Intergenic
1059093862 9:111391236-111391258 TCTGAGTTAGATTTCTGTGTGGG - Intronic
1059839961 9:118203534-118203556 TTTGAGTTATATTCCTTTGATGG - Intergenic
1059878464 9:118662447-118662469 CTTGTCTTAGATTTCTTGCTTGG + Intergenic
1061819209 9:133215921-133215943 TTTGAGTTAATTTTCTTGCAGGG - Intergenic
1062714606 9:138001832-138001854 TTTTAGTTAGATTTATTTCTGGG - Intronic
1186063268 X:5733734-5733756 TTTGAGTTTGTTTTCTTGCTAGG - Intergenic
1186405876 X:9302119-9302141 TTTAAATTAGATTTTTTGGATGG - Intergenic
1186812169 X:13201113-13201135 TTTGAATGAGATTGCTAGGTTGG - Intergenic
1187340711 X:18419221-18419243 GTTGAGTTAGACTTCTTCCTGGG + Intergenic
1189085515 X:38019109-38019131 TATAAGTTAGATTTCCTGGTAGG - Intronic
1189212108 X:39292216-39292238 TTTGAGTTAGATTGGTAGGGTGG + Intergenic
1191783323 X:64891974-64891996 TTCAAGTCTGATTTCTTGGTGGG - Intergenic
1192346611 X:70314125-70314147 TTTGAGGTAGATTTCGAGGGTGG + Intronic
1192711042 X:73588705-73588727 CTTGAGTTTTTTTTCTTGGTAGG + Intronic
1192711286 X:73592367-73592389 TTTGAGATATATTTCTTTGATGG + Intronic
1194479575 X:94404161-94404183 TTTCAGTTTGGTTTCTTAGTTGG + Intergenic
1194784160 X:98061822-98061844 TTTGACTTTCATTTTTTGGTGGG - Intergenic
1194933837 X:99923209-99923231 TTTGAGGTGAATTTCTTGGAAGG - Intergenic
1196121877 X:112060131-112060153 TTTGAATTTAAATTCTTGGTTGG + Intronic
1196134433 X:112191963-112191985 CTTGAGTTAAATTTCTTCCTAGG + Intergenic
1196277337 X:113782405-113782427 TTTGACTTAGAGTTCTTGGTGGG - Intergenic
1196500201 X:116372068-116372090 TTTGATTTATAATTATTGGTAGG - Intergenic
1196506223 X:116446719-116446741 TTTTGGTTACTTTTCTTGGTAGG + Exonic
1196744425 X:119056789-119056811 CTTGTTTTAAATTTCTTGGTGGG + Intergenic
1197264373 X:124352038-124352060 TTTGTGTTTGATTTCTTCCTTGG + Intronic
1199909330 X:152269264-152269286 TTTGAGTTAGATTGATTTTTAGG - Intronic
1201349290 Y:13021988-13022010 TTTGTTTTACATTTTTTGGTTGG + Intergenic
1201778257 Y:17690076-17690098 TTTGATTTGCATTTCTTGGATGG + Intergenic
1201823299 Y:18215916-18215938 TTTGATTTGCATTTCTTGGATGG - Intergenic