ID: 959651577

View in Genome Browser
Species Human (GRCh38)
Location 3:108756114-108756136
Sequence CAAGTGAGAGACTTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959651575_959651577 -5 Left 959651575 3:108756096-108756118 CCATGAAAGAGACTCATGCAAGT 0: 1
1: 0
2: 1
3: 18
4: 202
Right 959651577 3:108756114-108756136 CAAGTGAGAGACTTGGAACTTGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959651577 Original CRISPR CAAGTGAGAGACTTGGAACT TGG Intronic
902914031 1:19625038-19625060 CAAGTGACAGGCTTGCACCTAGG - Intronic
903643085 1:24873103-24873125 CAAGTGAGACACTGTGCACTGGG - Intergenic
906657310 1:47557961-47557983 CCAGTGAAAGACTTGGATTTTGG - Intergenic
906928057 1:50140159-50140181 CAAGTCAGGGGCTTGGAACCTGG + Intronic
907447337 1:54516972-54516994 GAAGAGAGAGACATGCAACTGGG - Intergenic
907603786 1:55795331-55795353 CAAGGGAGAAACTGGGAATTGGG - Intergenic
908903258 1:68980224-68980246 AATGTGAGAGACTTGGGGCTTGG - Intergenic
910145231 1:84072125-84072147 TTAGTGAGAGACGTGTAACTTGG - Intergenic
917160434 1:172051311-172051333 CAAGGGAGTGACCTGGAACTTGG - Intronic
919443859 1:197676266-197676288 AAAGAGAGAGACTTGGAAGGAGG + Intronic
920793211 1:209112462-209112484 CAAGTGACAGAGCTGGGACTTGG - Intergenic
921206872 1:212857123-212857145 CAAGTGGGCAGCTTGGAACTGGG - Intergenic
922960569 1:229642390-229642412 CTTGTGGGAGACTTGGACCTAGG + Intronic
923793675 1:237133175-237133197 TAAGTGAGATGCTTGGAATTGGG + Intronic
1063481759 10:6382564-6382586 GAAGTGAGAGACCTGGAATCTGG + Intergenic
1064090932 10:12383413-12383435 AAATTGAGTGACTTGCAACTCGG + Intronic
1064340353 10:14479960-14479982 CAAATGAGAACCATGGAACTAGG + Intergenic
1065523212 10:26592033-26592055 CAACTGAGAGGTTTTGAACTAGG - Intergenic
1066639973 10:37546147-37546169 CAAATCAGAGCATTGGAACTTGG - Intergenic
1066654873 10:37687879-37687901 CAACTGTGAGACTTGGGACAGGG + Intergenic
1066754165 10:38693099-38693121 TTAGTGAGAGAATTGGAACTTGG - Intergenic
1067319375 10:45203432-45203454 CAAGTGAGAGTCATCGAATTAGG - Intergenic
1068866040 10:61896942-61896964 CAAGAGAGACACAGGGAACTCGG - Intergenic
1072982516 10:100111382-100111404 CTAGTGAGAGAGTAGGAACAGGG + Intergenic
1074401644 10:113145971-113145993 AAAGTAAGAGACTTGAAACAAGG - Intronic
1075867656 10:125740281-125740303 CAAGTGAGAGTCTTTTAACACGG + Intronic
1079458179 11:20654833-20654855 CCAGTGAAGGATTTGGAACTGGG + Exonic
1081837202 11:46165553-46165575 AATGTGAGAAACTTGGAATTAGG - Intergenic
1081979505 11:47257747-47257769 AAGGGGAGAGACATGGAACTTGG + Intronic
1082256795 11:50041233-50041255 CAAGTCAGAGACTTTCACCTGGG - Intergenic
1083226969 11:61291369-61291391 CAGGTGAGACACGAGGAACTGGG + Intronic
1086772224 11:90780757-90780779 TAAGGGAGAGACTTGGAAGGAGG - Intergenic
1087526907 11:99326347-99326369 CAAGTGACAGCCTTGAAATTGGG - Intronic
1090022888 11:123143080-123143102 CATGTGAGAGACTTGGCCCAGGG - Intronic
1090335018 11:125956192-125956214 CAAGTGAAAGCCATGGTACTGGG + Exonic
1091026775 11:132148499-132148521 ACAATGAGAGACTGGGAACTAGG + Intronic
1094672947 12:32588583-32588605 CAGGTGCAAGACTTGGAGCTTGG + Intronic
1094694474 12:32804194-32804216 CAATTGAGGGACCAGGAACTGGG + Intronic
1095940858 12:47725813-47725835 CAGGTCTGAGACTTGGAAGTAGG - Intergenic
1096973250 12:55684056-55684078 CAAATGAGTGCCTTGGAGCTTGG - Exonic
1097411899 12:59265565-59265587 CAAGTAAGTAACTTGGAATTAGG + Intergenic
1098956890 12:76697052-76697074 AAAGTGAAAGAGTTAGAACTGGG + Intergenic
1100252131 12:92837443-92837465 CATGTGAGCGTCTTAGAACTGGG + Intronic
1100895361 12:99176187-99176209 CAGGTGAGAGACCAGGAAGTGGG + Intronic
1101633383 12:106517023-106517045 CAAGTGAGGCACTTAGAACAGGG + Intronic
1101968012 12:109294099-109294121 CAAGTGAGAGCCTGGGACCCAGG - Intronic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1110306349 13:73991853-73991875 GAAGAAAGAGCCTTGGAACTTGG + Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1114839662 14:26248436-26248458 CGTGGAAGAGACTTGGAACTGGG + Intergenic
1114952810 14:27778177-27778199 GAAGGGAAAGACTGGGAACTGGG - Intergenic
1115518147 14:34205972-34205994 CAAGTGATAGAGGTGGAGCTAGG - Intronic
1115710194 14:36042056-36042078 AAAGTCAGAAACTTGGAATTCGG + Intergenic
1117575940 14:57097551-57097573 CAAATGAGAAATTTGGATCTTGG + Intergenic
1117699981 14:58402946-58402968 CAAGTCGTAGACTTGGAAGTGGG + Intronic
1118903567 14:70006308-70006330 CATGTGCCAGACTTGGTACTGGG - Intronic
1119136983 14:72230053-72230075 CATCTGATAGACTTGGAATTGGG + Intronic
1120732864 14:88022646-88022668 GAACTGGGAGACTTGGAATTGGG - Intergenic
1120756825 14:88252434-88252456 CAAGTGAGTGACTCGGGTCTTGG + Intronic
1130377693 15:83344461-83344483 CAGCTGAGAGACTGGGCACTCGG - Intergenic
1131805320 15:96115884-96115906 CTAATGAGAGACTTGCAGCTTGG - Intergenic
1133927168 16:10202642-10202664 CAAGTGAGAGGCTTTGCACCAGG + Intergenic
1134199378 16:12185230-12185252 CATGTGAGAGACTAGGGAGTGGG + Intronic
1135544139 16:23354466-23354488 CACGTGACAGACTTGGCCCTGGG - Intronic
1136620812 16:31427517-31427539 CAGGTGAGAGACAGGGAGCTGGG + Intergenic
1136728566 16:32384036-32384058 TCAGTGAGAGAATTGGAACTTGG + Intergenic
1138754923 16:59472172-59472194 CAAAAGAGAGCTTTGGAACTGGG - Intergenic
1139425890 16:66879881-66879903 CAAGTGAGAGGCTTGGAATAGGG + Intronic
1139546045 16:67650044-67650066 CAAGAGACAGGCTTGGATCTAGG - Exonic
1140516858 16:75549522-75549544 CCAGTGACAGAATTGGGACTAGG + Intronic
1202997872 16_KI270728v1_random:133720-133742 TCAGTGAGAGAATTGGAACTTGG - Intergenic
1203024559 16_KI270728v1_random:446062-446084 TCAGTGAGAGAATTGGAACTTGG - Intergenic
1142547331 17:714226-714248 CTCGTGAGTGGCTTGGAACTGGG - Intronic
1148087547 17:45003476-45003498 CCTGTGAGAGGCTTGGAACCAGG - Intergenic
1151359805 17:73581989-73582011 CCAGGGTGAGACTTGGGACTGGG + Intronic
1151580921 17:74978178-74978200 CAAGGTGGAGTCTTGGAACTTGG + Intergenic
1153684435 18:7531201-7531223 TAAGTGAGAAACTTCTAACTTGG + Intergenic
1154083454 18:11280038-11280060 CAAGTGAGAGACTGGGAGGGAGG + Intergenic
1155025358 18:21935768-21935790 CAAGTGGCAGCCTTTGAACTGGG - Intergenic
1155597096 18:27500833-27500855 CAAGTGTGAAACTGAGAACTGGG - Intergenic
1156467521 18:37357109-37357131 CCAGTGGGAGACTTGGAAGAGGG + Intronic
1157290781 18:46408053-46408075 CAAGGGAGATATTTGGAAGTGGG + Intronic
1157309145 18:46538851-46538873 CAAGTGAGAGACTGGGAGCAGGG - Intronic
1160075153 18:75667531-75667553 CAAGGGAGAAACCTGGAAATGGG + Intergenic
1163136940 19:15318784-15318806 CAGATGAGGGTCTTGGAACTAGG - Intronic
1163963044 19:20715614-20715636 CAGAGGAGAGACTTGGAATTTGG - Intronic
1165825847 19:38705336-38705358 CTAGTGAGAGAGTTGGGCCTGGG + Intronic
1165870772 19:38971466-38971488 CTAGGGATAGATTTGGAACTTGG - Intronic
1167103907 19:47419510-47419532 CAAGGGAGAGACCGGGAACGGGG - Intronic
1167850187 19:52195326-52195348 TAAGTGAGAGAATAGGAATTGGG - Intronic
1168297836 19:55386243-55386265 GAAGAGAGCGACTGGGAACTTGG - Intronic
927098793 2:19770820-19770842 CAAGGGAGAGACTTGGTAAGAGG - Intergenic
928505444 2:31947317-31947339 TAAGTGAGAAACTTGGAGTTTGG - Intronic
930258895 2:49122596-49122618 AAAGGGAGAGACTTGTAACAGGG - Intronic
930360591 2:50373445-50373467 CAAGTGAGAGTATGGGAGCTAGG - Intronic
934317461 2:91937354-91937376 TCAGTGAGAGAATTGGAACTTGG - Intergenic
934484458 2:94690802-94690824 GAAGGGAAAGACTGGGAACTGGG + Intergenic
936710299 2:115123293-115123315 CAAGGGACAGACAGGGAACTAGG - Intronic
936995340 2:118408562-118408584 CAAAGGAGAGATTTGGAAATAGG - Intergenic
937297043 2:120815721-120815743 ACCGTGAGAGACTTGGAACCAGG + Intronic
938239540 2:129732759-129732781 CACGTGGGTGACTAGGAACTGGG - Intergenic
938765173 2:134456310-134456332 GAAAGGAGAGACTTGGAACCAGG + Exonic
941745440 2:169081892-169081914 AAGGTGAGAGACATGGAAGTGGG + Exonic
942132968 2:172898704-172898726 CAGGTGAGGGACTCTGAACTTGG - Intronic
944069728 2:195655661-195655683 CAATGGTGAGACTTGAAACTAGG + Intronic
1170344953 20:15375268-15375290 CTCGTGAGATACCTGGAACTTGG + Intronic
1171027789 20:21647809-21647831 GAAGTGTGAGACTTTCAACTTGG - Intergenic
1171934507 20:31260988-31261010 GAAGAGAGAGACTGGGAAATAGG + Intergenic
1173011513 20:39187300-39187322 CAAGTGAGAGAGTTGGAGGGAGG - Intergenic
1173314329 20:41930044-41930066 CATGTCAGAGATTTGGAATTGGG + Intergenic
1174688768 20:52481858-52481880 TAAGAGAGAGAACTGGAACTAGG + Intergenic
1176676153 21:9779370-9779392 CAAGCTAGGGAGTTGGAACTGGG + Intergenic
1177212937 21:18092139-18092161 CTACTGAGCCACTTGGAACTGGG - Intronic
1178463448 21:32824477-32824499 CAATTGAGAGACCAGGAAGTGGG + Intergenic
1180305641 22:11121189-11121211 TCAGTGAGAGAATTGGAACTTGG - Intergenic
1180544160 22:16483372-16483394 TCAGTGAGAGAATTGGAACTTGG - Intergenic
1180711323 22:17841561-17841583 CCAATGACAGACTTGGAGCTGGG + Intronic
1180963456 22:19773426-19773448 TATGAGAGAGACTTGCAACTGGG + Intronic
1181427225 22:22851537-22851559 CAAGAGAAAAACTTGGAAATGGG - Intronic
1181791872 22:25274226-25274248 CAAGGGAGGGAGTTGGAGCTGGG - Intergenic
1181827504 22:25530037-25530059 CAAGGGAGGGAGTTGGAGCTGGG - Intergenic
949911242 3:8909992-8910014 GAAGAGGGAGACTTGGAACTTGG + Intronic
950579397 3:13852645-13852667 CAAGTGAGGGACTGGCCACTTGG + Intronic
950969880 3:17175719-17175741 CAAGTAAGACTCTTTGAACTGGG + Intronic
954709596 3:52498817-52498839 CCAGGGAGAGACTAGGAAATTGG - Intronic
955342703 3:58137657-58137679 CAAGAGAGAGACTGGTCACTGGG + Intronic
956104210 3:65800026-65800048 TAAGTGGTAGACTTGGAATTAGG - Intronic
956421453 3:69090556-69090578 CACCTGAGAGATTTGGAATTTGG - Intronic
957445221 3:80307931-80307953 AAAGTGAAAGAGTAGGAACTGGG - Intergenic
959651577 3:108756114-108756136 CAAGTGAGAGACTTGGAACTTGG + Intronic
961723952 3:128913648-128913670 CAAGGAGGAGACTGGGAACTTGG + Intronic
962937066 3:140090904-140090926 CAAATGCCAGATTTGGAACTGGG + Intronic
963492868 3:146022891-146022913 AAAGTGAAAGACTTGAATCTTGG - Intergenic
964012914 3:151912420-151912442 CAAATGGGATACTTGGATCTAGG + Intergenic
964223013 3:154368054-154368076 AAAGTGAAAGAGTAGGAACTGGG - Intronic
964327462 3:155562838-155562860 CAACTTTGAGACTTGGAAGTGGG - Intronic
965382395 3:168006052-168006074 CAAGTGACAGAAATGCAACTAGG + Intergenic
966005299 3:175004001-175004023 CAGGTGAGGGTCCTGGAACTGGG - Intronic
966076063 3:175937494-175937516 GAAGTGAGGGACTTGGCACCTGG + Intergenic
966277326 3:178189927-178189949 AAAGGGAGAGACCTGGAGCTAGG + Intergenic
967030398 3:185600993-185601015 CCAGTGAGAGACTTGAACTTAGG + Intronic
967482111 3:189984859-189984881 CAAGAAAGTGACTTGGAATTTGG + Intronic
968799532 4:2733088-2733110 CAGGTGAGAGGTCTGGAACTGGG + Intergenic
969917207 4:10502400-10502422 CTAGGGAGAGACCTGGATCTTGG - Intronic
974384434 4:61186747-61186769 CAAGTCAGTCACTTGGCACTTGG + Intergenic
974692808 4:65321390-65321412 CAAGTGTGAGAAATGGAACAAGG - Exonic
975173001 4:71254619-71254641 CAAAATAGAGACTTAGAACTGGG - Intronic
975748201 4:77495045-77495067 CAAGTGAATGCCTTGGGACTGGG - Intergenic
977219020 4:94316870-94316892 CAAGAGGAAGACTTGGACCTGGG - Intronic
977949698 4:102955942-102955964 TCAGTGAGAGAATTGGAACTTGG - Intronic
978495687 4:109357023-109357045 CAGGTGAGACCATTGGAACTTGG - Intergenic
985399375 4:189579376-189579398 CAAGCTAGGGAGTTGGAACTGGG - Intergenic
985423020 4:189803257-189803279 CAAATGAGAGACTTGGATTCTGG - Intergenic
985883629 5:2659110-2659132 TAACGGAGCGACTTGGAACTTGG + Intergenic
986353763 5:6904261-6904283 CACAGGAGAGACTGGGAACTGGG + Intergenic
986697991 5:10375278-10375300 GCAGTGAGAGACTTGGCACCCGG + Intronic
988143778 5:27277427-27277449 CAAGCAAGAGACTTGGAAGGAGG + Intergenic
988592480 5:32561139-32561161 CAAGGGAGAAACTTTGAAGTGGG + Intronic
989414144 5:41153818-41153840 CAGGTGAGAGAGTTTGAAATGGG + Exonic
993037887 5:82777190-82777212 CAAGTGAGTGACCTGTATCTGGG - Intergenic
993110794 5:83655138-83655160 CACCTGTGAGACTTGGAAATAGG + Intronic
996592496 5:125162876-125162898 AAATTGAGAGACTGGGAAATTGG + Intergenic
996664740 5:126045927-126045949 CAAGTGAATCACTTGGACCTGGG + Intergenic
997847128 5:137296791-137296813 CAGGTGGGAGACTGGGGACTTGG + Intronic
998661576 5:144244710-144244732 AAAGTGAGAAACTAGGAATTGGG - Intronic
999879828 5:155849947-155849969 TAAGTCAGAGACTTTAAACTGGG + Intergenic
1000804957 5:165778613-165778635 GCAGGGAGAGACTTGAAACTAGG + Intergenic
1001032421 5:168272454-168272476 CAATTGAGAAACCTGGTACTAGG - Intergenic
1001063750 5:168518244-168518266 TAAATGAGACACTTGGAGCTGGG - Intronic
1002411106 5:179077168-179077190 TAAGTGAGAGGCTGGGAAATGGG + Intronic
1003990105 6:11478075-11478097 GAAGAGAGAAACTTGGATCTGGG + Intergenic
1006258836 6:32852337-32852359 CAAATGAGGGAGTTGGAAGTTGG - Intronic
1008017692 6:46540561-46540583 AAAATGAGAGAATTGGATCTTGG - Intergenic
1008485720 6:52033296-52033318 GAAGAGAGAGACTTGGAAGTAGG - Intronic
1011996773 6:93599468-93599490 CAAGAGAGAGAGTTGGGAGTGGG - Intergenic
1014713965 6:124842356-124842378 CAGGAGAGAGACTGGGAGCTGGG - Intergenic
1015600827 6:134908893-134908915 GAAGTGAGAGGCTTGGCCCTGGG - Intergenic
1016148471 6:140705980-140706002 CAAGTGAGAGACATGTGACATGG + Intergenic
1016377932 6:143443186-143443208 CATGTGAGAGAGCTGGGACTAGG + Intronic
1016894818 6:149041446-149041468 CAAGGAAGAGACCTGGAGCTGGG + Intronic
1021139405 7:17005493-17005515 CAACTGAGCGAGTTGGAAATTGG - Intergenic
1023948665 7:44823673-44823695 AAAGTGAGAGCCTTGGAGATGGG - Intronic
1024139412 7:46446513-46446535 AAAGTGAGTGACATGGAACATGG + Intergenic
1025985300 7:66445470-66445492 CAATTGAGAAACTTGGAATATGG - Intergenic
1028186170 7:87787911-87787933 AAAGTGAGTTTCTTGGAACTTGG - Intronic
1029568803 7:101357781-101357803 TAAGACAGAGACTTGGGACTTGG + Intergenic
1031723797 7:125210368-125210390 TAATGGAGAGACTTGGAACATGG - Intergenic
1032642593 7:133786296-133786318 AAAGTGAGAGACCTGGGGCTTGG - Intronic
1032946691 7:136861926-136861948 TAAGTGAGAGAATGGGAAATGGG - Intergenic
1032962707 7:137057017-137057039 CAAGGGAGAGATTTGGAAGCTGG + Intergenic
1036676363 8:10837239-10837261 CTAGTGAGAGACTCGGTGCTAGG - Intronic
1038478533 8:27885771-27885793 CAAGTGAGAGAATGGGGACATGG + Intronic
1039027258 8:33271246-33271268 CAGGTGAGAGCCATGGAACCTGG + Intergenic
1041044370 8:53877534-53877556 AAAGTGGGCGACTTGGAAATCGG - Intronic
1047138557 8:122108598-122108620 CATGTGAGAGAAGTGGGACTGGG + Intergenic
1051311752 9:15781950-15781972 GAAATGACAGACTTTGAACTTGG + Intronic
1053368857 9:37543720-37543742 TAAATGAGAGACCTTGAACTAGG - Intronic
1053673338 9:40393596-40393618 GAAGGGAAAGACTGGGAACTGGG - Intergenic
1053923143 9:43019956-43019978 GAAGGGAAAGACTGGGAACTGGG - Intergenic
1054384442 9:64533661-64533683 GAAGGGAAAGACTGGGAACTGGG - Intergenic
1054511289 9:65982692-65982714 GAAGGGAAAGACTGGGAACTGGG + Intergenic
1055849431 9:80608574-80608596 AAAGGGAGAGACTTTGCACTTGG + Intergenic
1056190594 9:84180676-84180698 CATTTGAGAGATGTGGAACTAGG + Intergenic
1056349094 9:85730425-85730447 CAAGTGAATGCCCTGGAACTAGG - Intronic
1058063484 9:100524031-100524053 CAACTGAGTGACTGGGAACAGGG - Intronic
1058387714 9:104458568-104458590 TAAGTGACAGAGTTGGAATTTGG - Intergenic
1060089006 9:120726690-120726712 CAAGTGCAAGACTTTGAAGTTGG + Intergenic
1060570010 9:124629805-124629827 CACATGAGTGACTTAGAACTTGG - Intronic
1062229334 9:135472736-135472758 CAAGGGAGACCCTTGGAAATGGG + Intergenic
1186589651 X:10916610-10916632 AACTAGAGAGACTTGGAACTAGG - Intergenic
1186829018 X:13371857-13371879 CAAGGGAGAGATGTAGAACTTGG - Intergenic
1187114841 X:16338719-16338741 CAAGTGAGAGTCTTAGCACTGGG + Intergenic
1187904758 X:24055149-24055171 CAGGAGGGAGACCTGGAACTGGG + Intronic
1188623507 X:32255898-32255920 CAAGTGAGAGACTTGAGTCTGGG + Intronic
1191142173 X:57126743-57126765 CAAGTGATTGATTTGGCACTGGG + Intergenic
1192995549 X:76508402-76508424 CAATTGTGAGACATTGAACTCGG - Intergenic
1194926134 X:99826468-99826490 AAAGTGAGAGAAATGGAAGTCGG + Intergenic
1196860053 X:120018211-120018233 CAAGTGAGTGACTTTGAGCAGGG - Intergenic
1199987177 X:152961129-152961151 CAAGGGAATGACCTGGAACTGGG - Intronic
1201184768 Y:11389775-11389797 TCAATGAGAGAATTGGAACTTGG - Intergenic
1201982048 Y:19918549-19918571 AAAGTGAAAGACTTAGAACTGGG + Intergenic