ID: 959654878

View in Genome Browser
Species Human (GRCh38)
Location 3:108791862-108791884
Sequence TTCTTGCCTCATCTAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959654873_959654878 26 Left 959654873 3:108791813-108791835 CCAGAGCTGTAGAAGAAATGCAC No data
Right 959654878 3:108791862-108791884 TTCTTGCCTCATCTAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959654878 Original CRISPR TTCTTGCCTCATCTAAAAGG AGG Intergenic
No off target data available for this crispr