ID: 959656300

View in Genome Browser
Species Human (GRCh38)
Location 3:108808621-108808643
Sequence TTAGAGATTCAGATTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959656300_959656303 0 Left 959656300 3:108808621-108808643 CCTCCCTGAATCTGAATCTCTAA No data
Right 959656303 3:108808644-108808666 TAACTATAGATAGCAGAGATAGG No data
959656300_959656304 29 Left 959656300 3:108808621-108808643 CCTCCCTGAATCTGAATCTCTAA No data
Right 959656304 3:108808673-108808695 TGTTACCACATAAATCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959656300 Original CRISPR TTAGAGATTCAGATTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr