ID: 959656958

View in Genome Browser
Species Human (GRCh38)
Location 3:108818328-108818350
Sequence TGGCCAATGAGGAAAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959656954_959656958 -6 Left 959656954 3:108818311-108818333 CCTCTGACTGTTGGGTTTGGCCA No data
Right 959656958 3:108818328-108818350 TGGCCAATGAGGAAAATGGGTGG No data
959656952_959656958 0 Left 959656952 3:108818305-108818327 CCTTTTCCTCTGACTGTTGGGTT No data
Right 959656958 3:108818328-108818350 TGGCCAATGAGGAAAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959656958 Original CRISPR TGGCCAATGAGGAAAATGGG TGG Intergenic
No off target data available for this crispr