ID: 959656958 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:108818328-108818350 |
Sequence | TGGCCAATGAGGAAAATGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
959656954_959656958 | -6 | Left | 959656954 | 3:108818311-108818333 | CCTCTGACTGTTGGGTTTGGCCA | No data | ||
Right | 959656958 | 3:108818328-108818350 | TGGCCAATGAGGAAAATGGGTGG | No data | ||||
959656952_959656958 | 0 | Left | 959656952 | 3:108818305-108818327 | CCTTTTCCTCTGACTGTTGGGTT | No data | ||
Right | 959656958 | 3:108818328-108818350 | TGGCCAATGAGGAAAATGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
959656958 | Original CRISPR | TGGCCAATGAGGAAAATGGG TGG | Intergenic | ||
No off target data available for this crispr |