ID: 959664621

View in Genome Browser
Species Human (GRCh38)
Location 3:108906646-108906668
Sequence TAAGAGCCAGAACATCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959664621_959664623 8 Left 959664621 3:108906646-108906668 CCTTGCTGATGTTCTGGCTCTTA 0: 1
1: 0
2: 1
3: 16
4: 202
Right 959664623 3:108906677-108906699 TTTCCCTTTTCACTTCTAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 297
959664621_959664622 5 Left 959664621 3:108906646-108906668 CCTTGCTGATGTTCTGGCTCTTA 0: 1
1: 0
2: 1
3: 16
4: 202
Right 959664622 3:108906674-108906696 ATGTTTCCCTTTTCACTTCTAGG 0: 1
1: 0
2: 3
3: 32
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959664621 Original CRISPR TAAGAGCCAGAACATCAGCA AGG (reversed) Intergenic
900797455 1:4717375-4717397 TGAGAGACAGAACATGAGCTGGG - Intronic
902980866 1:20121915-20121937 AAACAGCCAGAACATCAGGGAGG - Intergenic
904692875 1:32307862-32307884 TAATAGGAAGAACATGAGCACGG + Intronic
906037265 1:42759167-42759189 TCAGAGCCAGACCTTCAGCCAGG - Intronic
908696728 1:66851394-66851416 AAAGAGACAGAAAATCAGCAAGG + Intronic
909440547 1:75691162-75691184 CAAGAGCCTGAACACCAGCCAGG + Intergenic
913719454 1:121576858-121576880 TACGAGACAGAAAGTCAGCAAGG + Intergenic
917067074 1:171108399-171108421 ACAAAGGCAGAACATCAGCAAGG + Intronic
919649545 1:200132899-200132921 TGAGTCCCAGAACATCAGCATGG + Intronic
1063263616 10:4419741-4419763 TAAGAGCCAGAAAATCAGTAAGG + Intergenic
1063522007 10:6749657-6749679 TAACAGCTAGAACATCAAAAGGG + Intergenic
1063710204 10:8469961-8469983 TATGAGTGAGAACAGCAGCATGG - Intergenic
1067294352 10:44966437-44966459 CAAGAGCCTGGACATCAGCTGGG - Intronic
1068188681 10:53620690-53620712 GAACAGACAGAAAATCAGCAAGG + Intergenic
1074510827 10:114110439-114110461 TAGGAGCCTGGACACCAGCAGGG + Intergenic
1075280387 10:121133748-121133770 AAAGAGCCAGGACAAGAGCAAGG + Intergenic
1076874862 10:133211026-133211048 TGAGAGCCAGAAGGTCAGCTGGG + Intronic
1077863382 11:6202806-6202828 TGAGAGACAGACCATCTGCAGGG - Intergenic
1078843356 11:15099661-15099683 TAAGAGACACAACAGCAGCAAGG - Intergenic
1079456936 11:20644772-20644794 CAAGATATAGAACATCAGCAGGG + Intronic
1083241183 11:61390205-61390227 AAACAGCAGGAACATCAGCATGG - Intergenic
1085177297 11:74501053-74501075 AATGAGACAGAAAATCAGCAAGG - Intronic
1085506293 11:77062335-77062357 TAAGATCAAGAACATCACAAGGG - Intergenic
1085687971 11:78641844-78641866 TAATGGACAGAAAATCAGCAAGG - Intergenic
1085817035 11:79748792-79748814 TTCTAGCCACAACATCAGCATGG + Intergenic
1086905983 11:92418499-92418521 TAACAACCAGGACAACAGCAAGG - Intronic
1088728508 11:112660081-112660103 TGAGGCCCATAACATCAGCAGGG - Intergenic
1093092602 12:14938222-14938244 TCAGAGACAGACCATCAGTAGGG - Intronic
1094355569 12:29574048-29574070 TAATAGTCAGAATTTCAGCAGGG + Intronic
1095892133 12:47244722-47244744 CAAGAGCCCGACTATCAGCATGG + Intergenic
1097338581 12:58412439-58412461 TCATAGCCAGAGCAGCAGCATGG + Intergenic
1097478716 12:60093024-60093046 TAAAAGACATAACATCATCATGG - Intergenic
1098458536 12:70704475-70704497 GAGGATCCAGAACATCATCAGGG + Intronic
1099691868 12:85965198-85965220 TAAGATGCAGAACACCAACATGG - Exonic
1102398780 12:112610790-112610812 TAAGATACAGAACATTAGCTGGG - Intronic
1102948325 12:117010194-117010216 TAAGTGGCAGAACATCTTCACGG + Intronic
1106971708 13:35148120-35148142 CAAGAGCCCGAACACCAGCTGGG - Intronic
1107640220 13:42434712-42434734 TAAGAGCCAGTCCATCAGTGTGG - Intergenic
1111219470 13:85184879-85184901 AAAGAGCCAGAATCTGAGCATGG + Intergenic
1111825525 13:93262820-93262842 CAAGAGCCTGGACATCAGCTGGG - Intronic
1112626500 13:101110648-101110670 AAACAGCCAGAGGATCAGCAGGG - Exonic
1113511373 13:110857364-110857386 AAAGAGCCAGAACTTGTGCAAGG - Intergenic
1113726891 13:112610851-112610873 TATGAGACAGAAAATCAGCAAGG + Intergenic
1116400897 14:44505706-44505728 ATAGAGGCTGAACATCAGCAAGG + Exonic
1117638010 14:57767177-57767199 TACTAGACAGAAAATCAGCAAGG + Intronic
1118329466 14:64804274-64804296 TGAGAGGCAGAACTTCAGCATGG + Intronic
1121312396 14:92942235-92942257 TAAAAGCCAGTACATGTGCAGGG + Intronic
1124395250 15:29295023-29295045 TTAGAGCCAGACCATCGGGAGGG + Intronic
1124622409 15:31281459-31281481 CAACAGACAGAAAATCAGCAAGG - Intergenic
1124717291 15:32076211-32076233 AAAGAGACAGAAAATCAGCAAGG - Intronic
1126381285 15:48049928-48049950 TCAGAGCCAGAAGAACAGGAAGG - Intergenic
1126619872 15:50627483-50627505 GAAGAGCAAGAACGTCAACAAGG + Intronic
1129378887 15:75153307-75153329 TGAGAGCCAGCCAATCAGCAAGG + Intergenic
1130246014 15:82249957-82249979 TAAGAGTCAGAACCACAGAAAGG + Intronic
1130628927 15:85545608-85545630 TAAGAGCTAGATCTGCAGCAAGG - Intronic
1131640785 15:94290783-94290805 TCAGAGCTAGAAAATCATCAGGG + Intronic
1133443497 16:5840283-5840305 CCAGAGGCAGAACATCTGCATGG + Intergenic
1134593016 16:15472299-15472321 TACTAGACAGAAAATCAGCAAGG - Intronic
1134783046 16:16916276-16916298 TACGAGGCAGAATAGCAGCAGGG - Intergenic
1135312933 16:21419683-21419705 TAAGCAACAAAACATCAGCAGGG + Intronic
1135365856 16:21851963-21851985 TAAGCAACAAAACATCAGCAGGG + Intronic
1135445958 16:22519199-22519221 TAAGCAACAAAACATCAGCAGGG - Intronic
1136309598 16:29398410-29398432 TAAGCAACAAAACATCAGCAGGG + Intronic
1136323046 16:29500191-29500213 TAAGCAACAAAACATCAGCAGGG + Intronic
1136437730 16:30240159-30240181 TAAGCAACAAAACATCAGCAGGG + Intronic
1137500127 16:49004686-49004708 TCAGAGCCAGAAAATCACCCTGG + Intergenic
1137891505 16:52167541-52167563 TGAGAGGCAGGACATTAGCATGG + Intergenic
1138597584 16:58037270-58037292 TAAGAGCCAGAACAAAGGCCAGG - Intronic
1140341778 16:74171829-74171851 CAAGATCCAGTACACCAGCAGGG + Intergenic
1140993047 16:80232790-80232812 CAAGAGCCAGAGCATTAGAATGG + Intergenic
1143809371 17:9458442-9458464 TAAGAGCCAGCATATTGGCAGGG - Intronic
1145175033 17:20692958-20692980 TAAATGCCAAAAAATCAGCAAGG - Intergenic
1145416604 17:22718515-22718537 CAAGAGCCAGAGCATGAGAAGGG - Intergenic
1153590223 18:6665966-6665988 TAAGAGCCACAAATTCAGAAAGG - Intergenic
1155101166 18:22611668-22611690 TAAGAGCCAAAGCATTAGCTGGG + Intergenic
1155334094 18:24747290-24747312 TAAGAGAAAGAATATCAGAAGGG - Intergenic
1157413840 18:47485770-47485792 TCAGTCCCAGAACATCAGAATGG - Intergenic
1157740413 18:50087919-50087941 TAAGAGCCACAAGAGCAGCAGGG + Intronic
1157754007 18:50202431-50202453 TAAGAGCAAGAAAGTCAGCTGGG + Intergenic
1158441379 18:57477261-57477283 TCACAGCCACAACATCAGAATGG + Exonic
1158920937 18:62190281-62190303 TAAAATACAGAACATCGGCAGGG + Intronic
1159146808 18:64465179-64465201 GAAGAGCAAGAAGATCAGCAAGG + Intergenic
1162315938 19:9937852-9937874 TAAGAGCCTGGACACCAGCTGGG - Intergenic
1165182374 19:33983469-33983491 AACGAGACAGAAAATCAGCAAGG + Intergenic
1165345709 19:35248077-35248099 TAAGAGCCAGAATTTCCGGAGGG + Intergenic
1168282515 19:55312973-55312995 GAAGAGCGCGAACAGCAGCATGG + Exonic
1168546624 19:57257300-57257322 TACTAGACAGAAAATCAGCAAGG - Intergenic
926262671 2:11281328-11281350 TAAGATCAAGAACAAAAGCAAGG + Intronic
926457961 2:13092315-13092337 CAGGAGCCAGCACATCAGCTGGG - Intergenic
926709893 2:15870755-15870777 CAAGAGCTAGAACATCGGGATGG - Intergenic
926742239 2:16121836-16121858 TAAGAGATAAAACATGAGCAGGG + Intergenic
931135759 2:59398835-59398857 TAGGAGCAAGAACAAGAGCAGGG + Intergenic
931795407 2:65703498-65703520 TAGTAGACAGAAGATCAGCAAGG + Intergenic
932473794 2:71986414-71986436 TAATAGACAGAAAATCAGCAAGG - Intergenic
935097914 2:99964200-99964222 TACTAGACAGAAAATCAGCAAGG + Intronic
935169399 2:100599255-100599277 TTACAGGCAGAGCATCAGCATGG + Intergenic
935940364 2:108231118-108231140 AAAGAGCCAAAGCATCATCATGG - Intergenic
936144019 2:109967180-109967202 TGAGAGCTAGAACATTTGCAAGG + Intergenic
936180701 2:110265141-110265163 TGAGAGCTAGAACATTTGCAAGG + Intergenic
936200668 2:110404289-110404311 TGAGAGCTAGAACATTTGCAAGG - Intronic
938652582 2:133399158-133399180 TAAGAAGCAGAACCTCATCAGGG - Intronic
938838294 2:135131150-135131172 TAAAAGCCAGTGCTTCAGCATGG - Intronic
940844093 2:158621310-158621332 CAACAGCCAGAACGTGAGCAAGG + Exonic
941513749 2:166445944-166445966 TACGATTCAGAACATAAGCATGG + Intronic
941678498 2:168370242-168370264 TAAGAACAAGAACTTCAGCCGGG + Intergenic
944632378 2:201640675-201640697 TAAAAGCCTGAATATCAACATGG - Intronic
945537895 2:211042320-211042342 TAAGCGAAAGAACTTCAGCAAGG - Intergenic
1168868643 20:1110138-1110160 TAGGAGCCAGATCAGCAGAAAGG + Intergenic
1168904183 20:1390968-1390990 TGAGACCCAGAACACCATCAGGG - Intronic
1169584159 20:7061138-7061160 TGGGAGCCAGGACATCTGCATGG - Intergenic
1169797115 20:9474946-9474968 TAAGAGCAAAAACATAAGCTAGG - Intronic
1170080326 20:12467969-12467991 TAAGAGGCAAAACTTCAGCGTGG - Intergenic
1172759128 20:37309624-37309646 GATGAGCCAAAACATCATCAGGG - Intronic
1177950851 21:27535229-27535251 GAATAGCCAGAACACCAGGACGG + Intergenic
949779842 3:7673969-7673991 TATGAGCCATAACTTCAGAAAGG + Intronic
949978405 3:9481836-9481858 TAATAGCCACAAGACCAGCATGG + Intergenic
950131989 3:10553688-10553710 GAAGAGCCAGAGCAGCAGCTCGG + Intronic
951657986 3:25030721-25030743 TAAAAGCCAGATCTTCAGCAGGG - Intergenic
952935054 3:38390922-38390944 TAAGAAATAGAACATCAGCCAGG + Intronic
953022537 3:39124842-39124864 TTACAGCCAGAACATGAGCTAGG + Intronic
955379872 3:58429318-58429340 AAAGATCCAGAACCTCAGAAGGG + Intronic
955847278 3:63179235-63179257 TAAGAGCTAGAAAATGAGCCAGG + Intergenic
956633610 3:71341057-71341079 AATGAGGCAGAAGATCAGCAAGG + Intronic
956676548 3:71738747-71738769 TGCTAGACAGAACATCAGCAAGG + Intronic
956874413 3:73447768-73447790 TAGGAGAAAGAACATCAACATGG - Intronic
956985744 3:74697979-74698001 TAAGAGCCATAACTCCAGTAAGG - Intergenic
957228385 3:77478118-77478140 AAAGAGCTAAAACATCAGCTGGG - Intronic
959664621 3:108906646-108906668 TAAGAGCCAGAACATCAGCAAGG - Intergenic
959727987 3:109566664-109566686 TACTAGACAGAAAATCAGCAAGG - Intergenic
960181533 3:114585933-114585955 GCAGAGCCAAAACGTCAGCAGGG + Intronic
960953761 3:123016777-123016799 GACTAGCCAGAACAACAGCAAGG - Intronic
963417927 3:145022839-145022861 AAAGAGCCAGAACTTCATCCTGG - Intergenic
963845598 3:150153231-150153253 CAACAGGCAGAAAATCAGCAAGG + Intergenic
964498384 3:157320163-157320185 TAAGAGCAGGACCATCATCATGG - Intronic
967620808 3:191631102-191631124 AAAGAGCCACAGCATCAGTAAGG - Intergenic
968052521 3:195665051-195665073 TAAAATACAAAACATCAGCAAGG - Intergenic
968849825 4:3071655-3071677 TAAGCCCCAGAACCTCAGAATGG + Intergenic
970946450 4:21698455-21698477 TAATAGCCAGAACAATTGCAAGG + Intronic
971097622 4:23425793-23425815 TAAGAGCCAGAACAGTGCCAAGG - Intergenic
971883497 4:32411935-32411957 TATGAGACAGAAAATCAACAAGG + Intergenic
972273721 4:37537292-37537314 AAACAACTAGAACATCAGCAAGG + Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975841770 4:78481746-78481768 TTTGAGCCAGAAAATCAGCGAGG - Intronic
976484271 4:85583410-85583432 CAAGAGACAGAACTTCAGAAGGG + Intronic
978248503 4:106603905-106603927 AAAGAGCCATAACACCAACAGGG - Intergenic
978347885 4:107790424-107790446 TAAGTGCCTGAAAATAAGCATGG + Intergenic
978672444 4:111266742-111266764 AAACAGCCATAACATCAGAAAGG - Intergenic
980314877 4:131185747-131185769 CAAGAGCCAGAAAAACATCAGGG + Intergenic
980482199 4:133401420-133401442 TAAAATCCAGAAACTCAGCAAGG + Intergenic
983599868 4:169515330-169515352 TACTAGACAGAAAATCAGCAAGG - Intronic
983926911 4:173412509-173412531 TCAGAGACAGAGTATCAGCAAGG - Intergenic
984067527 4:175066964-175066986 TAAGAGCCAGTACTTCATGAAGG - Intergenic
984088337 4:175339778-175339800 TAAGAGACATAAATTCAGCAGGG - Intergenic
986328104 5:6694610-6694632 TAAGAACTAGAACACCAGAAAGG + Intergenic
988290060 5:29272908-29272930 AAAGAGACAGAAAATTAGCAAGG + Intergenic
988471520 5:31544025-31544047 AAAGAGCCAGACCCTCGGCATGG + Intronic
991490935 5:67182086-67182108 TAAGAGCCAGAACACCAGATAGG + Intergenic
991666591 5:69005784-69005806 TAAGAACCAGACCCTCAGCCAGG + Intergenic
995702250 5:114949384-114949406 TGAGAGCCAAAGCAACAGCAGGG - Intergenic
997150871 5:131493409-131493431 TAACAGCCAGGAGATAAGCAAGG - Intronic
997223179 5:132187387-132187409 TAAGAAGCAGAACGTCAGAAAGG - Intergenic
997427010 5:133810160-133810182 CAAAAGCCAGAAGATCTGCATGG - Intergenic
1005799424 6:29405444-29405466 CAAGAGCCAAAGCATCACCATGG + Intronic
1006620678 6:35361755-35361777 CAAAAGCCAGACCCTCAGCAAGG - Intronic
1008135393 6:47770522-47770544 TATGAGCCAGAAAATCTGCTGGG - Intergenic
1008569852 6:52806220-52806242 CAAGAGCCAGAGCATAAGGAAGG + Intergenic
1009247679 6:61259773-61259795 TACTAGACAGAAAATCAGCAAGG + Intergenic
1010284416 6:74058698-74058720 CAACAGGCAGAAAATCAGCAAGG + Intergenic
1010347554 6:74829694-74829716 TAAGAGACAGAATATTACCAAGG + Intergenic
1010793877 6:80096472-80096494 AACGAGGCAGAAAATCAGCAAGG - Intergenic
1012030463 6:94053856-94053878 TAAGTGCCAGAGCAGCAGCAGGG + Intergenic
1014648736 6:124008653-124008675 TAGAAGCAAGAAGATCAGCAAGG - Intronic
1016895968 6:149053432-149053454 TATGACCCTGAACATGAGCATGG - Intronic
1017869476 6:158474582-158474604 CGAGAGCCAGAGCAACAGCAAGG - Intronic
1019693432 7:2431039-2431061 TATGAGGCAGAAAATCAGCAAGG - Intronic
1020404123 7:7812729-7812751 TAAAAACCACAAAATCAGCAGGG + Intronic
1022650095 7:32266698-32266720 TAAGGGCCAGAACCTCAGAGAGG - Intronic
1024411214 7:49044540-49044562 TAAGAGTCAGATCATCTGGATGG + Intergenic
1024823802 7:53365526-53365548 AAAGAAACAGGACATCAGCAGGG + Intergenic
1025954321 7:66170805-66170827 GAAGGGCCAGAACATGGGCAGGG + Intergenic
1026423794 7:70269281-70269303 GAAGAGCCAGAACTGCAGCAAGG - Intronic
1028165392 7:87532717-87532739 TCATAGGCAGAACAGCAGCATGG - Intronic
1031466115 7:122114358-122114380 TAGGAGCAACAACATCACCAGGG - Intronic
1031932992 7:127705219-127705241 TAAAACCCAGAACTTAAGCAAGG - Intronic
1032056366 7:128687817-128687839 AAACAGCCAGAGCACCAGCATGG - Intergenic
1033414848 7:141152616-141152638 CAGGAGCAAGAACATTAGCAGGG + Intronic
1034082328 7:148290785-148290807 TTAGAGCCAGAATAGCACCAGGG - Intronic
1034085238 7:148316406-148316428 TCAGAGCATGACCATCAGCAAGG + Intronic
1034187268 7:149188026-149188048 TAAGAATTAGAACATCAGGAAGG + Intergenic
1035270971 7:157719636-157719658 GCAGGGCCAGACCATCAGCAGGG + Intronic
1039475841 8:37839029-37839051 GAAGAGGCAGAGCAGCAGCAAGG - Exonic
1039738593 8:40358823-40358845 TAAGAGCCAGGACATCTGGATGG + Intergenic
1040423687 8:47263192-47263214 TGAGAGCCTGAACAAAAGCAAGG - Intronic
1041777908 8:61544363-61544385 AATGAGGCAGAACATCAGAATGG - Intronic
1041972995 8:63764962-63764984 AAATAGGCAGAAAATCAGCAAGG - Intergenic
1045079849 8:98614132-98614154 AAATAGACAGAAAATCAGCAAGG + Intronic
1046026241 8:108727642-108727664 TATGAGCCAGAAGCTCAGGAGGG + Intronic
1046386026 8:113510793-113510815 TAAGAGCCTGAAAATCTGCTTGG + Intergenic
1046669612 8:117043307-117043329 TCAGAGACAGGAAATCAGCATGG + Intronic
1048682647 8:136862032-136862054 TAATAGTCAGAAAATCAGTAAGG - Intergenic
1052223916 9:26060893-26060915 TACTAGCCAGGATATCAGCAAGG - Intergenic
1055937221 9:81614402-81614424 TCAGAGACTGAACACCAGCAAGG + Intronic
1056626034 9:88254116-88254138 TAAGAGCCTGGACATCAGCTGGG + Intergenic
1057611256 9:96545791-96545813 TATGAGGCAGGACTTCAGCAGGG - Intronic
1057804997 9:98213442-98213464 TTCCAGCCAGAACATCAGCCAGG - Intronic
1059496243 9:114711632-114711654 TAACCGCCAGAACCTCAGAATGG + Intergenic
1059616238 9:115954325-115954347 TAAGAGCTAGAAAAGAAGCAAGG - Intergenic
1203455368 Un_GL000219v1:162114-162136 AAAGAGACAGAAAATTAGCAAGG + Intergenic
1187314778 X:18183071-18183093 AACCAGACAGAACATCAGCAAGG + Intronic
1188240805 X:27786882-27786904 TAGGAGCCAGAACTTAAGAAGGG - Intergenic
1188592743 X:31859076-31859098 TCAGAGCCACAAGGTCAGCAGGG + Intronic
1189426132 X:40902302-40902324 AACTAGCCAGAAAATCAGCAAGG + Intergenic
1190727530 X:53199408-53199430 TAAGATCCAGATCAGCAGAAAGG + Intronic
1191881358 X:65846502-65846524 TGAGAGCCAGAATATAGGCAAGG - Intergenic
1193763678 X:85498293-85498315 AAAGACCCAGGACATCAACATGG - Intergenic
1195786070 X:108525040-108525062 TGAGAGACAGAAGATCAACAAGG - Intronic
1197464484 X:126785822-126785844 TAATAGGCAGAGCAGCAGCATGG + Intergenic
1197640524 X:128962064-128962086 TACCAGGCAGAATATCAGCAAGG + Intergenic
1197665877 X:129222922-129222944 GAAGAGCCACAACAGTAGCAGGG - Intergenic
1198319854 X:135510081-135510103 TGTCAGCCAGAACATCAACATGG + Intergenic