ID: 959666730

View in Genome Browser
Species Human (GRCh38)
Location 3:108931301-108931323
Sequence TTTTAGGTACAGTACATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959666726_959666730 0 Left 959666726 3:108931278-108931300 CCTTAGAACATTTGATATTTTAT 0: 1
1: 0
2: 3
3: 67
4: 561
Right 959666730 3:108931301-108931323 TTTTAGGTACAGTACATGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 117
959666725_959666730 1 Left 959666725 3:108931277-108931299 CCCTTAGAACATTTGATATTTTA 0: 1
1: 1
2: 2
3: 51
4: 576
Right 959666730 3:108931301-108931323 TTTTAGGTACAGTACATGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959666730 Original CRISPR TTTTAGGTACAGTACATGGG TGG Intronic
902131729 1:14267482-14267504 TTTGACTTAAAGTACATGGGAGG + Intergenic
902195129 1:14792679-14792701 TTTAAGGTCCAGGACATGGCTGG + Intronic
903136865 1:21315040-21315062 TATTAATTACAGTACAAGGGAGG - Intronic
907113690 1:51950063-51950085 TTTTAGGCACAGGACAGGTGAGG + Intronic
909154895 1:72061715-72061737 TTTTAGATACATTACTTGGAGGG - Intronic
912399037 1:109373215-109373237 TTTCAGGCACAGTGCAGGGGAGG + Intronic
912566930 1:110594160-110594182 TATTAGAGACAGGACATGGGAGG + Intronic
913967490 1:143389053-143389075 TTTAAGGTACATTCCATGGAAGG + Intergenic
914061864 1:144214647-144214669 TTTAAGGTACATTCCATGGAAGG + Intergenic
914117286 1:144751707-144751729 TTTAAGGTACATTCCATGGAAGG - Intergenic
914325361 1:146609759-146609781 TTTTGTGTAGAGTAGATGGGAGG + Intergenic
917091472 1:171357849-171357871 TTTGAGTCACAGTACATGGGTGG - Intergenic
917895664 1:179484615-179484637 TGATGGGTAGAGTACATGGGCGG - Intronic
920754896 1:208719830-208719852 TTTCAGGAAGAATACATGGGTGG - Intergenic
922201784 1:223409212-223409234 TTTCAGGGACTGTAAATGGGTGG + Intergenic
1067572636 10:47383183-47383205 TTTTATGTACATTAGATAGGAGG - Intronic
1072031926 10:91529590-91529612 TTTTAGGTAGAAGACCTGGGTGG - Intergenic
1072112011 10:92331431-92331453 TTTTAGGTAAAGATTATGGGGGG - Intronic
1073021078 10:100444445-100444467 TTTTAGGTAGAGACCATGGCAGG - Intergenic
1075288543 10:121208514-121208536 TTCTAGGTACAGAGCCTGGGAGG + Intergenic
1078487649 11:11738977-11738999 TTTTAGGTAGATTAGTTGGGAGG - Intergenic
1079356079 11:19731208-19731230 TTTTATGTACAGGAAATGGGAGG - Intronic
1079572128 11:21955914-21955936 TTATAGGTACATAACATTGGAGG + Intergenic
1082764857 11:57159106-57159128 TTTCATGAACTGTACATGGGAGG + Intergenic
1085344653 11:75760524-75760546 TTCTAGGTTCCTTACATGGGTGG - Intronic
1086034732 11:82402814-82402836 TTTTATGTTCAGCACATGGCTGG - Intergenic
1089685361 11:120143304-120143326 TTTCAGGTACCCTACCTGGGAGG + Intronic
1090494235 11:127194072-127194094 CTTTTGATTCAGTACATGGGTGG - Intergenic
1090608578 11:128450399-128450421 TTTTAGCTTCAATACATGGCTGG + Intergenic
1091945403 12:4536530-4536552 TCTTAGGGAGAGTTCATGGGTGG + Intronic
1098026278 12:66205838-66205860 TTGTAGGCATAGTACCTGGGAGG - Intronic
1098516574 12:71384075-71384097 TTTTAGTTACAGTTCCTGGTTGG - Intronic
1106044505 13:26126079-26126101 TTCTAGGTACTGTACAAGCGTGG + Intergenic
1109364513 13:61338662-61338684 TTTTAGGTACCTTACCTGTGAGG - Intergenic
1111066327 13:83097367-83097389 TTTTAGGTACAGGACAAAAGAGG - Intergenic
1112716034 13:102187049-102187071 ATTTAGGTAGAGTACATATGGGG + Intronic
1115903893 14:38185600-38185622 TTTTAGGTACTCTACTTGAGAGG - Intergenic
1121621810 14:95355421-95355443 TTCCAGGTACAGTAAATGGTGGG - Intergenic
1122673255 14:103388225-103388247 TTTTAAATACACTACATGGCTGG - Intronic
1125270695 15:37935641-37935663 TTTTGGGAAGGGTACATGGGAGG - Intronic
1126738301 15:51752897-51752919 TGTAAGGTACTGTACATTGGTGG + Intronic
1127559503 15:60121880-60121902 TTTGAGGCACAGTAGTTGGGGGG - Intergenic
1133853723 16:9529881-9529903 CTTTAGGGAGAGTACATGGCAGG - Intergenic
1133983090 16:10648085-10648107 TTTGATGTACAGCACATGGGTGG + Intronic
1135471323 16:22734132-22734154 TTTTAGGTACAGTGTGTGGTGGG - Intergenic
1137966609 16:52940442-52940464 TGTTAGGAACAGGACCTGGGAGG + Intergenic
1138717514 16:59041147-59041169 TTTAAGATAAAGTACATAGGTGG - Intergenic
1140008200 16:71101188-71101210 TTTTGTGTAGAGTAGATGGGAGG - Intronic
1143244393 17:5470525-5470547 ATTTAGGTAATGTAAATGGGTGG + Intergenic
1143550366 17:7626991-7627013 TTTCATCTACAGTACATGGAAGG - Exonic
1149563633 17:57626882-57626904 TTTAAGGTAAAGTACATGCAGGG + Intronic
1151618603 17:75231239-75231261 TTTGAGGGACAGGACATGTGGGG + Intronic
1156831745 18:41499993-41500015 TTAAAGGTATAGTACATGGTAGG - Intergenic
1160028017 18:75234803-75234825 TTTTATGAACAGCAAATGGGAGG - Intronic
1165042440 19:33078711-33078733 GTTTAGTGACAGTACTTGGGAGG - Intergenic
1168416257 19:56170813-56170835 TTTTAGGGAAAGTTCATGGGAGG - Intergenic
1202701276 1_KI270712v1_random:166521-166543 TTTAAGGTACATTCCATGGAAGG + Intergenic
924985760 2:268056-268078 TTTTAGGTCCAGATCTTGGGAGG + Intronic
933585617 2:84176685-84176707 TTTTAGGTACAGTACATTTTAGG - Intergenic
934172191 2:89549954-89549976 TTTAAGGTACATTCCATGGAAGG + Intergenic
934282502 2:91624306-91624328 TTTAAGGTACATTCCATGGAAGG + Intergenic
939139567 2:138337486-138337508 TTTTAATTACATTACATGAGGGG - Intergenic
945307527 2:208272406-208272428 TGAAAGGAACAGTACATGGGAGG + Intronic
1170079801 20:12461762-12461784 TTTTAGATACATTATATGAGTGG - Intergenic
1171114967 20:22517581-22517603 TTTTAGGAAAAGTTCTTGGGTGG - Intergenic
1171331771 20:24346161-24346183 TTTTATGTACAGCATATGTGAGG - Intergenic
1175310587 20:58009006-58009028 TTTTATGTTCAGGACAGGGGAGG + Intergenic
1177979500 21:27893365-27893387 TTTTATGTAAAGTAGATGGCAGG - Intergenic
1184429637 22:44434336-44434358 TTTTAGGTAGAGTAGAGGGGAGG - Intergenic
1185363775 22:50425217-50425239 TTCTAGGTACAGTTTATGAGTGG + Intronic
950175977 3:10874735-10874757 TTTTAGGTACCTCACATGAGTGG + Intronic
955954831 3:64278069-64278091 TTTTAGGCACATTACTTTGGAGG + Intronic
957343959 3:78938692-78938714 TCTTACGTATAGTACATGGACGG - Exonic
958641346 3:96811704-96811726 TTGTAAGTACAGTGCATGGGGGG + Intergenic
958819956 3:98962149-98962171 TTTTTGGTACATTCCATGGTGGG + Intergenic
959666730 3:108931301-108931323 TTTTAGGTACAGTACATGGGTGG + Intronic
965025383 3:163295724-163295746 TTTTAGATACATTATATGGGTGG - Intergenic
966443920 3:179979083-179979105 TTTAAGGGACAGTACTTGGCTGG + Intronic
967533495 3:190576083-190576105 TTTGAGGTAAAGTACAAGGTAGG - Intronic
972708306 4:41567838-41567860 TTTTAAGGACATTACCTGGGAGG - Intronic
974493247 4:62594175-62594197 TTTCAGGTAGAGAACATTGGTGG + Intergenic
980371375 4:131878180-131878202 TTTTAGGTACACTTAATGGTAGG + Intergenic
980823745 4:138049303-138049325 TTTTAGGTAGTGTACCTGTGTGG - Intergenic
988847780 5:35146482-35146504 TATTGTGTTCAGTACATGGGTGG + Intronic
989087001 5:37686191-37686213 TTGTAGTCACAGTACTTGGGAGG + Intronic
990938438 5:61175289-61175311 TGTTAGTTACAGTAGATGTGAGG - Intergenic
991502260 5:67288871-67288893 TTTTAGGTACCTTATATGAGGGG + Intergenic
991718255 5:69472261-69472283 TTATAGGTACAGATAATGGGTGG + Intergenic
995539963 5:113175951-113175973 TGGTTGGTACAGTACATAGGGGG - Intronic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
999094773 5:148968225-148968247 TTTTAGGTAGAGTCCTTGAGTGG - Intronic
1000629666 5:163578108-163578130 TTGCAGTTACAGTACAGGGGAGG - Intergenic
1003624513 6:7728933-7728955 TTTGAGGGAGAGAACATGGGGGG + Intronic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1004949833 6:20656581-20656603 CTCTAGGTTCAGTACATAGGGGG - Intronic
1006515759 6:34544753-34544775 TTTTAAGCACAGTACATGTGTGG - Intronic
1008231308 6:48987341-48987363 CTTTAGGTAGAGTACATCAGAGG - Intergenic
1010123346 6:72405270-72405292 TGTTATGAACTGTACATGGGAGG + Intergenic
1011894143 6:92202780-92202802 TATTAGGAACTGTACATGTGAGG + Intergenic
1012758422 6:103263746-103263768 TTATAGGTACAGGATAGGGGCGG - Intergenic
1015540647 6:134310265-134310287 TCTTAGCTACAGTGCTTGGGAGG - Intronic
1015822229 6:137276228-137276250 ATTAAGGTACAGTCTATGGGGGG + Intergenic
1017604313 6:156117314-156117336 TTTTAGTTTCTCTACATGGGAGG - Intergenic
1018692312 6:166356920-166356942 TGTTAGGTACAGGAGGTGGGAGG - Intergenic
1025593160 7:62889472-62889494 TTTTAGGTAGAATCCATGGAGGG + Intergenic
1027599763 7:80225322-80225344 TTTTAGTTCCAATACATGGAGGG + Intergenic
1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG + Intronic
1031432211 7:121685697-121685719 ATTTAGGTAAAGTACATGTTAGG - Intergenic
1032014135 7:128366167-128366189 TTTCAGGTACTGTGCATGGGAGG - Intergenic
1032730874 7:134641785-134641807 TTTTAGGAGCAGTGCATGGTGGG + Intergenic
1033497308 7:141912088-141912110 TTTTAGGTACCTTACATTTGTGG - Intronic
1039955773 8:42206262-42206284 TTTTAGGTGGAATAAATGGGTGG + Intronic
1041286535 8:56268118-56268140 TTTTAGGAACAGTTCATGTAAGG + Intergenic
1045243642 8:100424095-100424117 TTTTAGGTAGAGAACTAGGGAGG + Intergenic
1046892674 8:119440010-119440032 ATTTAAATATAGTACATGGGAGG - Intergenic
1052595667 9:30554855-30554877 TTTTGGGTAAAGTACATTTGGGG + Intergenic
1058326676 9:103707149-103707171 TTTTATGTTAAGTACATGGAGGG - Intergenic
1059171971 9:112133537-112133559 TTTTATGTACGGTAAATGGCAGG - Intronic
1187021453 X:15386990-15387012 TTTGAGATACAGGACGTGGGAGG + Intronic
1187358071 X:18597484-18597506 TTTTAAGTTCAGTACTTGGAGGG - Intronic
1188612434 X:32116997-32117019 TCTTAGGTTCATTACTTGGGGGG - Intronic
1189640431 X:43064048-43064070 TTCTAGGTAGAGCACATGTGGGG + Intergenic
1191709178 X:64130668-64130690 TTTTAGGTACCCCACATGAGTGG - Intergenic
1193276143 X:79590292-79590314 TGGTAGGGACAGTGCATGGGAGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1202162783 Y:21952911-21952933 TTTTAGGTTGAGTCCAGGGGTGG + Intergenic
1202228573 Y:22633457-22633479 TTTTAGGTTGAGTCCAGGGGTGG - Intergenic
1202314584 Y:23562710-23562732 TTTTAGGTTGAGTCCAGGGGTGG + Intergenic
1202556218 Y:26107885-26107907 TTTTAGGTTGAGTCCAGGGGTGG - Intergenic