ID: 959667733

View in Genome Browser
Species Human (GRCh38)
Location 3:108940545-108940567
Sequence CATGATTGGCAGCCATTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959667733 Original CRISPR CATGATTGGCAGCCATTGCA AGG Intronic
900167653 1:1249962-1249984 CCTGTTTGGCAGCCAAGGCAGGG + Intergenic
900643788 1:3699604-3699626 CACCACTGGCAGCCATGGCATGG - Intronic
902707287 1:18214297-18214319 AATGATTTACAGCCTTTGCAGGG - Intronic
905823772 1:41014410-41014432 CATGAATGGCAGCCGAGGCAGGG + Intergenic
906423156 1:45687406-45687428 CCTGGTTGCCAGCCATTACACGG - Exonic
907650153 1:56287129-56287151 CAAAATTGGCAGCCAAAGCAGGG - Intergenic
907738785 1:57142647-57142669 CACGGTTGGCAGCCATTGCTAGG + Intronic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
914225689 1:145717976-145717998 CATGATTGCCACCCAGTGCCAGG - Intergenic
915330077 1:155105935-155105957 CATGACTGGGAGCCACTGGAGGG + Intergenic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
920093808 1:203472710-203472732 GATCATTGGCAGCAATGGCAGGG - Intergenic
922430110 1:225543055-225543077 ATTGATAGGAAGCCATTGCAGGG + Intronic
924113264 1:240721329-240721351 CAAGATATGCACCCATTGCAGGG - Intergenic
1064120917 10:12618112-12618134 CATGATTAGCAGCCGATTCAGGG + Intronic
1064392986 10:14957575-14957597 TAAGATGGGAAGCCATTGCAGGG + Intergenic
1065661396 10:28007301-28007323 CATGATTGGCCATGATTGCATGG + Intergenic
1069214927 10:65807655-65807677 CATGATTGGTAACCAATGGAAGG - Intergenic
1074305793 10:112277147-112277169 GATGATTGAAGGCCATTGCATGG - Intergenic
1076228623 10:128801555-128801577 GATGATTTTCAGCCATTTCATGG - Intergenic
1079856186 11:25608610-25608632 CACTTTTGGCATCCATTGCATGG + Intergenic
1085348830 11:75785322-75785344 CATGATGGGCCCCCATTACATGG + Intronic
1085814879 11:79727343-79727365 CATGCTTCTCAGCCACTGCAGGG + Intergenic
1086864794 11:91967549-91967571 CATTTTTGGCACCCATTGAATGG - Intergenic
1087515451 11:99154277-99154299 CACCAGTGGCAGCCATGGCACGG + Intronic
1089462384 11:118660772-118660794 CAGGATAGGCAGCCATTGACAGG + Intronic
1090111095 11:123910443-123910465 CATGCTTCACAGCCACTGCAAGG - Intergenic
1094207683 12:27858014-27858036 ACTGATTGGCAGCCATTGTGAGG - Intergenic
1095137581 12:38624457-38624479 CATGATAGGGAGCCATTAAAAGG - Intergenic
1097144965 12:56933800-56933822 TCTGATTGGAAGCCACTGCATGG - Intronic
1097637240 12:62137834-62137856 CATGTTGGAGAGCCATTGCAGGG - Intronic
1105812417 13:24007146-24007168 CCTGATTGCCAAGCATTGCAAGG + Intronic
1110807066 13:79768067-79768089 CATTAGTGGCAGCCATAGAAAGG - Intergenic
1113615228 13:111675767-111675789 CATAGTTCACAGCCATTGCAGGG - Intergenic
1113620695 13:111760680-111760702 CATAGTTCACAGCCATTGCAGGG - Intergenic
1114401744 14:22416440-22416462 CAAGATTGAAAACCATTGCATGG + Intergenic
1114727434 14:24953991-24954013 CTGAATTGGCAGCCTTTGCAAGG - Intronic
1114964887 14:27945088-27945110 TATTATTGGCAGACATTGTAAGG - Intergenic
1119496612 14:75084979-75085001 TAAGATTGGCAGCTATAGCAGGG - Intronic
1122312179 14:100804310-100804332 CAAGGTTGGCAGCCATGCCAGGG - Intergenic
1127905985 15:63376390-63376412 GATGATTGGGAGCCCTTTCATGG + Intronic
1128619929 15:69140193-69140215 CCTGATTGGCAGCCATTTCGAGG + Intergenic
1129815669 15:78551221-78551243 CAAGATGGGAAGCCATTGGAGGG - Exonic
1130864302 15:87919052-87919074 CATTATTGTCTGCCACTGCATGG - Intronic
1132987048 16:2772757-2772779 CATGATGGGAAGCCACTGGATGG - Intronic
1136147738 16:28325448-28325470 CATGCTTGGCAGGCAGTACAGGG - Intergenic
1136287792 16:29254434-29254456 CATACTTTGCAGCCACTGCAGGG + Intergenic
1136999796 16:35218545-35218567 CATGATTGTAAGCCAATTCATGG + Intergenic
1138539401 16:57679326-57679348 CAGGCCTGGCAGCCACTGCAGGG + Intronic
1140081594 16:71753306-71753328 TATGTTAGGAAGCCATTGCAGGG - Intronic
1140891727 16:79290705-79290727 CATCATTGGAAGCTGTTGCACGG - Intergenic
1143226037 17:5304277-5304299 CATTATAAGTAGCCATTGCATGG + Intronic
1144428269 17:15166186-15166208 CCAGATTTGCTGCCATTGCAGGG - Intergenic
1145218536 17:21070078-21070100 CATGGACGGCAGCCACTGCAGGG + Intergenic
1146884474 17:36461975-36461997 CTGGCTTGGCAGCCATGGCAAGG - Intergenic
1147352659 17:39863808-39863830 CCAGATTTGCAGCCATTTCAGGG + Intronic
1148045032 17:44738249-44738271 CATGATTTCCAGCTCTTGCAAGG + Intronic
1151946933 17:77324756-77324778 TATGATTTGCTGCCATTCCATGG + Intronic
1154483174 18:14856227-14856249 GATGATTGGCAGCCAGAGAAAGG + Intergenic
1154483595 18:14857850-14857872 GATGATTGGCAGCCAGAGAAAGG + Intergenic
1154484016 18:14859470-14859492 GATGATTGGCAGCCAGAGAAAGG + Intergenic
1157392382 18:47313705-47313727 CATGGCTGCCAGCCAATGCATGG + Intergenic
1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG + Intronic
1166437687 19:42782948-42782970 CATGAATGGCCTCCATGGCAGGG - Intronic
1166456638 19:42946746-42946768 CATGAATGGCCTCCATGGCAAGG - Intronic
1166466592 19:43037610-43037632 CATGAATGGCCTCCATGGCAGGG - Intronic
1166493501 19:43280667-43280689 CATGAATGGCCTCCATGGCAAGG - Intergenic
1167811153 19:51831663-51831685 CATGATGGGAAGCTATTGGAGGG - Intergenic
925300449 2:2807889-2807911 CTTGATTCGCAGCCTTTGGAAGG - Intergenic
930902366 2:56522940-56522962 TATCATTGGCAGCCATCCCATGG - Intergenic
937835472 2:126466811-126466833 CTTGATTGGCAGCCCCTGCTGGG + Intergenic
938555979 2:132424654-132424676 TATCCTTGGAAGCCATTGCAGGG + Intronic
938703437 2:133899423-133899445 CCTGAGGGGCAGACATTGCAGGG - Intergenic
939357207 2:141118206-141118228 AATAATTGGCAGCCATTTCTAGG - Intronic
939958746 2:148547825-148547847 CTTGAGTGGCAGGCATTTCATGG + Intergenic
940592439 2:155747347-155747369 CATGATTGACTGTCACTGCAAGG - Intergenic
942543125 2:177035339-177035361 GAGGAATGGCAGCCATTGTAGGG - Intergenic
948329656 2:237155096-237155118 CATGATTGGCAGCTAGTGGAGGG - Intergenic
949060854 2:241956560-241956582 GATGATGGGCAGACATGGCAGGG + Intergenic
1169840440 20:9929834-9929856 CATTATTGGCAGCTAGTGAAGGG + Intergenic
1170525576 20:17232935-17232957 CATGAATGGCAGCCATGTCTAGG - Intronic
1171083895 20:22218028-22218050 CATGCTTGGCAGCCAAGGCAAGG + Intergenic
1172078104 20:32315096-32315118 CATGACAGGAAGCCACTGCAGGG - Intronic
1173243151 20:41316089-41316111 CATGACAGGCAAACATTGCATGG - Intronic
1173376457 20:42488082-42488104 CATGATTTTCAACCATTGCATGG + Intronic
1173622338 20:44446104-44446126 AATGATGGGAAGCCATTGGAGGG - Intergenic
1176797438 21:13380387-13380409 GATGATTGGCAGCCAGAGAAAGG - Intergenic
1178355207 21:31905636-31905658 CATTATTCCCAGCCAGTGCAGGG + Intronic
1180133757 21:45846574-45846596 CATGACTGTCAGCCATGGCAAGG - Intronic
1181812965 22:25415454-25415476 CAGGCTTGGCACCCACTGCATGG + Intergenic
1182862363 22:33571098-33571120 AATTATTAACAGCCATTGCAAGG - Intronic
1184003279 22:41690679-41690701 CCTGAGTGGGAGCCAGTGCAGGG + Exonic
1185110089 22:48896001-48896023 CATGGTTGGCATCAATGGCATGG - Intergenic
1185314657 22:50173889-50173911 CTTGGTGGGCAGCAATTGCAGGG - Intronic
951760741 3:26144738-26144760 CAAGATTGGGAGCTATTTCAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953749701 3:45599934-45599956 GAAGATTGGCAGTCATTGCCTGG + Intronic
955191565 3:56766458-56766480 CATCACTGGCAGCCACTGCCAGG + Intronic
955393083 3:58535345-58535367 CATGGTATGCAGCCATTGCTTGG + Intronic
956301136 3:67773841-67773863 TATGCTTGGAAGCCATTGAAGGG + Intergenic
956375647 3:68610715-68610737 CAGGATTGGGAGCTATTGAAGGG + Intergenic
958435358 3:94089310-94089332 GATAATTGGCAGCCAGTGCCAGG + Intronic
959667733 3:108940545-108940567 CATGATTGGCAGCCATTGCAAGG + Intronic
965422430 3:168478524-168478546 CTTGATTGGCAGCCATTCTAAGG + Intergenic
966253666 3:177893236-177893258 CATGTTTGGCAGATATTGTATGG + Intergenic
970257261 4:14181456-14181478 CAAGACTGGCAGACAGTGCAAGG + Intergenic
971449119 4:26783817-26783839 CATGGTTGCCAGGCATTGTAGGG - Intergenic
979883226 4:125988652-125988674 TATGATTGGCAGCCTTGGAAAGG - Intergenic
979998840 4:127464884-127464906 CATAATTAGAAGCCATTGAAAGG + Intergenic
981224714 4:142280066-142280088 CATCCTTGCCAGCCATTGTAAGG - Intronic
983423712 4:167555180-167555202 CATGATTTTCAGCCATTTAAAGG - Intergenic
986108129 5:4680351-4680373 CATGATCTGGTGCCATTGCATGG + Intergenic
987360443 5:17101767-17101789 CAGAATTGTCAGCCATGGCAAGG - Intronic
988623731 5:32849260-32849282 CATCACTGGGAGCCATTGCAGGG - Intergenic
988792330 5:34620121-34620143 CACGATTGCCAGCCATTGAAGGG + Intergenic
989532151 5:42520465-42520487 AATGAATGGCAGACAGTGCAGGG - Intronic
990343879 5:54852214-54852236 AATGATTGGCAGGCATAGCCAGG - Intergenic
992819427 5:80481207-80481229 CACTAGTGGCAGACATTGCAGGG + Intergenic
993956719 5:94243321-94243343 CCTGAATGGCAGGCCTTGCAGGG + Intronic
994870780 5:105347741-105347763 CATTATAGGCAGCAATTCCAAGG - Intergenic
995214491 5:109580050-109580072 CAGCAGTGGCAGCCATAGCACGG + Intergenic
996983256 5:129526390-129526412 CATGATAGGAAACCATTGCTGGG - Exonic
997263304 5:132479969-132479991 AATGATTGGTAGCAATTGCTTGG - Intergenic
998288530 5:140888393-140888415 GATGTTTGGCAGCAATTGGATGG - Intronic
998599897 5:143574919-143574941 GGTGATAGGAAGCCATTGCAGGG - Intergenic
1000294283 5:159899419-159899441 CATGATTGACAGCCAATGCCTGG + Intergenic
1001118280 5:168957602-168957624 CAGGCTTGGCAACCATTGCTAGG - Intronic
1001949458 5:175806111-175806133 GGTGATGGGGAGCCATTGCAGGG - Intronic
1003871641 6:10408692-10408714 TATGTTTAGCAGCCCTTGCATGG - Intronic
1007683184 6:43648586-43648608 CTTAATTGGAAGCCATTGGAAGG + Intronic
1011442420 6:87400714-87400736 CATGGTGGGCTGCCAATGCATGG + Intergenic
1012470264 6:99564798-99564820 CATGTTTGTCAGGCATAGCAAGG + Intronic
1012520441 6:100115068-100115090 GATGATGGGCACCCACTGCATGG + Intergenic
1017878926 6:158546309-158546331 CATCATTGGCAGCTATGTCAGGG + Intronic
1020764290 7:12301439-12301461 GATAATTGGCAGCCAGTGCCAGG - Intergenic
1024109507 7:46130985-46131007 AATGACTGGCAGCCAGTACAGGG - Intergenic
1024478653 7:49841007-49841029 CAAGATTGGATGCCACTGCAAGG + Intronic
1024700125 7:51898014-51898036 CCTGATTGGCACTCATTGCTGGG + Intergenic
1026150797 7:67786571-67786593 CATGAATGGAAGCCATCACAGGG + Intergenic
1028508820 7:91599179-91599201 TATGATTGGAAGTCATTGGATGG + Intergenic
1031599358 7:123687286-123687308 TATGATGGGAAGCCATTGGAGGG - Intronic
1036562739 8:9910972-9910994 CATGATGGGCATCTACTGCAGGG + Intergenic
1038296523 8:26296433-26296455 GATGATTGTCAGGCATTCCAAGG - Intronic
1041594824 8:59636697-59636719 CATGCTTGGCAGCCCTTGGGTGG + Intergenic
1042256629 8:66810772-66810794 CATGGTTGGTAGCCATTCTATGG + Intronic
1044288121 8:90434540-90434562 GATGATTGGCAACCAAAGCAAGG + Intergenic
1045760799 8:105604465-105604487 TGTGATGGGAAGCCATTGCATGG - Intronic
1047511213 8:125517204-125517226 CATGATGGGCAGCCCTTGCTTGG - Intergenic
1048353623 8:133635568-133635590 AATGATAGGGAGCCATTGGAGGG + Intergenic
1049566446 8:143341540-143341562 CATGGAGGGCAGCCATTGCTGGG - Intronic
1050517712 9:6462466-6462488 CATGATTTGCATCCATATCAGGG - Intronic
1053416649 9:37951037-37951059 CATGAGTGGCAGGAATTGCATGG - Intronic
1053667217 9:40324745-40324767 CATGATGGGCTCCCACTGCAGGG - Intronic
1054378361 9:64464773-64464795 CATGATGGGCTCCCACTGCAGGG - Intergenic
1054517393 9:66051538-66051560 CATGATGGGCTCCCACTGCAGGG + Intergenic
1058835303 9:108854808-108854830 CAGGAGCGGCAGCCACTGCAGGG + Exonic
1061156105 9:128862736-128862758 CAGGATCGGCTTCCATTGCAGGG + Intronic
1061942258 9:133890109-133890131 CAGGAGTGGCAGCCAGGGCATGG + Intronic
1062206497 9:135340449-135340471 CCTGATTGCCAGCCATGCCAGGG - Intergenic
1186212718 X:7266861-7266883 TATAATTGGCAACCATTCCACGG - Intronic
1186923774 X:14309843-14309865 AATGATAGGCAGCCAATGGAAGG - Intergenic
1187277561 X:17829147-17829169 CTTGATTTGCAGTCATTTCAAGG + Intronic
1196098838 X:111827820-111827842 CATGATAGGGAGCCATGGGAGGG - Intronic
1200205417 X:154312090-154312112 CAAGATTGGAAACCATTGAAGGG - Intronic
1201585682 Y:15558522-15558544 CATAATTGGCAACCACTTCATGG - Intergenic
1202337053 Y:23823401-23823423 CATTCCTGGCAGCCATTCCAAGG - Intergenic
1202533712 Y:25846670-25846692 CATTCCTGGCAGCCATTCCAAGG + Intergenic