ID: 959667833

View in Genome Browser
Species Human (GRCh38)
Location 3:108941516-108941538
Sequence CAGGGGAATGAAATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 725}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959667833_959667845 27 Left 959667833 3:108941516-108941538 CCCTCCTCCATTTCATTCCCCTG 0: 1
1: 0
2: 6
3: 75
4: 725
Right 959667845 3:108941566-108941588 CAGTTTTGCCCTTTGGAAATGGG 0: 1
1: 0
2: 1
3: 53
4: 493
959667833_959667842 20 Left 959667833 3:108941516-108941538 CCCTCCTCCATTTCATTCCCCTG 0: 1
1: 0
2: 6
3: 75
4: 725
Right 959667842 3:108941559-108941581 ATTAGTCCAGTTTTGCCCTTTGG 0: 1
1: 0
2: 2
3: 21
4: 208
959667833_959667844 26 Left 959667833 3:108941516-108941538 CCCTCCTCCATTTCATTCCCCTG 0: 1
1: 0
2: 6
3: 75
4: 725
Right 959667844 3:108941565-108941587 CCAGTTTTGCCCTTTGGAAATGG 0: 1
1: 0
2: 3
3: 37
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959667833 Original CRISPR CAGGGGAATGAAATGGAGGA GGG (reversed) Intronic
900324453 1:2101397-2101419 CAAGGGAAAGAAAGGAAGGAGGG - Intronic
900877507 1:5354688-5354710 CAGGGGAATGACATGAATTATGG - Intergenic
900886310 1:5417978-5418000 CAGGGGAAGGACATGGACCAAGG - Intergenic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901461024 1:9391991-9392013 CAGGGGATTGCAATAGAGAAAGG - Intergenic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902858813 1:19229529-19229551 CAGGGGAGTGAACTGGAGTGTGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903325450 1:22566360-22566382 CAGCGAAATGGAATGGGGGAAGG + Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904198335 1:28802530-28802552 CATGGGAATGAACTGCAGGCAGG + Intergenic
904650946 1:32005533-32005555 CAAGGGACTGGATTGGAGGAAGG + Intergenic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905293302 1:36938177-36938199 CAGGGGCAGGAAGTGGTGGATGG + Intronic
905709580 1:40089828-40089850 GAGGGGAAGGAAATGGGGGTGGG - Intronic
906087945 1:43152023-43152045 GCTGGGAATGAAATGAAGGAAGG - Intronic
906414219 1:45607431-45607453 CAGGACAGTGAAATGGAGAAGGG + Exonic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906651014 1:47512883-47512905 AAGGGGACTGAAATGGTGGGAGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907229215 1:52979907-52979929 AAAGGGAAAGAAAGGGAGGAAGG - Intronic
907512138 1:54969724-54969746 GAGGGGAATGAACTGGAGTGAGG + Intergenic
907520154 1:55018561-55018583 CAGGGCTATGACAAGGAGGAAGG + Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908890721 1:68844387-68844409 GAGGGGAATGGAATGGAAGAGGG + Intergenic
909041809 1:70662373-70662395 CGGGGGAAGGAAATGGACAAAGG - Intergenic
909417674 1:75425886-75425908 AAGGGCACTGAAAGGGAGGAAGG - Intronic
910226194 1:84938907-84938929 CAGGGGTATGAAGTAGAAGACGG + Intronic
911061425 1:93751346-93751368 CAGGGGAACCAAATAGATGAGGG - Intronic
911369422 1:96978790-96978812 CATGGGAGAGAAATGGAGGCAGG - Intergenic
911567517 1:99480576-99480598 CAGGTGAATGGAATGCAGGATGG + Intergenic
912402375 1:109405817-109405839 AAATGGACTGAAATGGAGGAGGG + Intronic
913459183 1:119065347-119065369 CAAGAAAATAAAATGGAGGAGGG + Intronic
913518146 1:119622617-119622639 CAGGGGAAGGAAGTGGGGAAGGG - Exonic
915562385 1:156694739-156694761 GATGGGAATGAGATGGAGCAAGG + Intergenic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916736497 1:167612023-167612045 TGGGGGAGTGAAAGGGAGGAGGG - Intergenic
917716016 1:177738740-177738762 TGGGGGAATGAAATGAAGAATGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918559640 1:185849109-185849131 GATGGGAATGAAAGGTAGGAAGG - Intronic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919145554 1:193629997-193630019 CACTGGAATGTAATAGAGGAAGG + Intergenic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920816689 1:209341085-209341107 CAGGGGAAAGTAAGGGAGAAAGG - Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
921587092 1:216960346-216960368 CAGCTGAATGGAATTGAGGAAGG - Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
922059349 1:222072895-222072917 AAGGGGAATGAAAGGATGGAAGG - Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922887072 1:229028346-229028368 GAGGAGAATGGAAGGGAGGAAGG + Intergenic
923458794 1:234188787-234188809 CAGGGGAGTGAAATGGACTCTGG - Intronic
924140154 1:241013621-241013643 CTGAGCTATGAAATGGAGGAGGG - Intronic
924226534 1:241926738-241926760 GCAGGGAATGAACTGGAGGAAGG - Intergenic
924841499 1:247714400-247714422 CAGGGGTATGAATTGTGGGAAGG - Intergenic
924845551 1:247766605-247766627 CAGGGGTAGGGAATGGAAGACGG + Intergenic
1063095607 10:2906115-2906137 CAGGGGAATGAATGGACGGAGGG - Intergenic
1063908966 10:10810630-10810652 CAGGGGAGTGGAAGGGAAGATGG + Intergenic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1064753213 10:18553158-18553180 CAATGGAATGGAATGGAGAATGG - Intronic
1064753278 10:18553530-18553552 GAATGGAATGAAAGGGAGGATGG + Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1064753392 10:18554386-18554408 GAATGGAATGAAATGGAGAATGG + Intronic
1064753441 10:18554735-18554757 TATGGGAATGGAATGGAGAATGG + Intronic
1064753497 10:18555140-18555162 ATGGAGAATGGAATGGAGGATGG + Intronic
1064753576 10:18555695-18555717 CAGTGGAATGGAATGGAGAATGG + Intronic
1064753587 10:18555768-18555790 GAGCGGAATGGAATGGAGAATGG + Intronic
1064753661 10:18556298-18556320 CAGTGGAATGCAATGGAGAATGG + Intronic
1064753728 10:18556705-18556727 GAAGGGAATGGAATGGAGAATGG + Intronic
1064753748 10:18556839-18556861 CAAGGGAATGGAATGGAGGAAGG + Intronic
1064753753 10:18556861-18556883 GAAGGGAATGGAATGGAGAAAGG + Intronic
1064753770 10:18556944-18556966 GAAGGGAATGGAATGGAGAATGG + Intronic
1064753775 10:18556966-18556988 GAAGGGAATGGAATGGAGAATGG + Intronic
1064753942 10:18558189-18558211 CAGTGGAATGCAATGGAGAATGG + Intronic
1064753956 10:18558262-18558284 GAAGGGAATGGAATGGAGAATGG + Intronic
1064754085 10:18559127-18559149 GAGTGGAATGAAATGGAGAATGG + Intronic
1064754343 10:18560878-18560900 GAATGGAATGGAATGGAGGATGG + Intronic
1064754396 10:18561260-18561282 GAATGGAATGGAATGGAGGATGG + Intronic
1064754446 10:18561622-18561644 GAATGGAATGGAATGGAGGATGG + Intronic
1064754480 10:18561901-18561923 CAATGGAAAGAAATGGAGAATGG + Intronic
1064754487 10:18561949-18561971 GAGTGGAATGGAATGGAGAATGG + Intronic
1064754611 10:18562801-18562823 GAATGGAATGAAAGGGAGGATGG + Intronic
1064754672 10:18563240-18563262 GAAGGCAATGAAATGGAGAATGG + Intronic
1064754700 10:18563448-18563470 AAAGGGAATGAAATGGAGAACGG + Intronic
1064754720 10:18563586-18563608 CAATGGAATGGAATGGAGAATGG - Intronic
1064754807 10:18564239-18564261 TATGGGAATGGAATGGAGAATGG - Intronic
1064754814 10:18564290-18564312 GAGTGGAATGGAATGGAGAATGG - Intronic
1064754937 10:18565148-18565170 AAAGGGAATGAAATGGAGAATGG - Intronic
1064754957 10:18565317-18565339 GAAGGGAATGGAATGGAGAATGG - Intronic
1064754966 10:18565361-18565383 GAAGGGAATGAAATGGAGAGTGG - Intronic
1064754979 10:18565432-18565454 GAGTGGAATGAAATGGAGAATGG - Intronic
1064755023 10:18565766-18565788 GAATGGAATGAAAGGGAGGATGG - Intronic
1064755033 10:18565817-18565839 CAATGGAATGGAATGGAGAATGG - Intronic
1064755167 10:18566712-18566734 GAATGGAATGAAATGGAGAATGG - Intronic
1064755184 10:18566831-18566853 GAGTGGAATGGAATGGAGAATGG - Intronic
1064755222 10:18567095-18567117 GAATGGAATGAAATGGAGGATGG - Intronic
1064755275 10:18567475-18567497 GAATGGAATGGAATGGAGGATGG - Intronic
1064755316 10:18567751-18567773 GAATGGAATGAAATGGAGAAAGG - Intronic
1064755343 10:18567957-18567979 ATGGGGAATGGAATGGAGAAAGG - Intronic
1064755405 10:18568411-18568433 CAATGGAATGAAATGGAGAATGG - Intronic
1064755485 10:18568970-18568992 GAAGGGAATGGAATGGAGAATGG - Intronic
1064755523 10:18569212-18569234 GAGTGGAATGAAATGGAGAATGG - Intronic
1064755535 10:18569285-18569307 GAATGGAATGGAATGGAGGATGG - Intronic
1064755573 10:18569511-18569533 GAATGGAATGGAATGGAGGATGG - Intronic
1064755648 10:18569997-18570019 TAGTGGAATGCAATGGAGAATGG - Intronic
1064755656 10:18570069-18570091 CAGTGGAATGGAATGGAGAATGG - Intronic
1064755667 10:18570149-18570171 GAGTGGAATGGAATGGAGAATGG - Intronic
1064755725 10:18570526-18570548 GAGCGGAATGGAATGGAGGATGG - Intronic
1064755735 10:18570582-18570604 CAGTGGAATGGAATGGAGAATGG - Intronic
1064755809 10:18571097-18571119 AAGTGGAATGGAATGGAGAATGG - Intronic
1064755817 10:18571172-18571194 GAAGGGAATGGAATGGAGAATGG - Intronic
1064755834 10:18571272-18571294 GAAGGGAATGGAATGGAGAAAGG - Intronic
1064755863 10:18571467-18571489 GAAGGGAATGGAATGGAGAATGG - Intronic
1064755917 10:18571791-18571813 CAGTGTAATGGAATGGAGGATGG - Intronic
1064755931 10:18571903-18571925 AAGGGGAATGGAATGGAGAAAGG - Intronic
1064755957 10:18572066-18572088 GAAGGGAATGGAATGGAGAATGG - Intronic
1064755989 10:18572258-18572280 GAAGGGAATGGAATGGAGAATGG - Intronic
1064755994 10:18572280-18572302 GAGTGGAATGAAATGGAGAATGG - Intronic
1064756050 10:18572597-18572619 GAATGGAATGAAATGGAGAATGG - Intronic
1064756062 10:18572693-18572715 GAAGGGAATGGAATGGAGAATGG - Intronic
1064756085 10:18572814-18572836 ATGGAGAATGGAATGGAGGATGG - Intronic
1064756094 10:18572870-18572892 GAATGGAATGAAATGGAGAAAGG - Intronic
1064756101 10:18572916-18572938 GAATGGAATGGAATGGAGGATGG - Intronic
1064800836 10:19069947-19069969 AAGGGAAATGAAAGGGAGAATGG - Intronic
1064962157 10:20977162-20977184 AAGGGCAGTGAAATGGAGGTCGG - Intronic
1065497208 10:26341785-26341807 CAGGAGAATGGAAGGAAGGAAGG + Intergenic
1065497245 10:26341946-26341968 CAGGAGAATGGAAGGAAGGAAGG + Intergenic
1066247547 10:33598048-33598070 CAGGGGAAAAAAATTGAGGCAGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1067041107 10:42953699-42953721 CAGGGGCACAAAATAGAGGATGG + Intergenic
1069878844 10:71579387-71579409 CAGAATAATGAAATGGGGGAGGG - Intronic
1070342764 10:75512661-75512683 CAGAGGAATGAAATGGGCGGAGG + Intronic
1070511638 10:77166591-77166613 GAGGGGAAGGACATGGAGGAGGG + Intronic
1070565024 10:77597633-77597655 GAGGGGAAGGAATTGGAGGAGGG - Intronic
1070738816 10:78888402-78888424 GGGGGGAATGCAATGGAGCAGGG - Intergenic
1070850191 10:79557054-79557076 CAGGGGAATGAAGTGGCTAAGGG + Exonic
1071069688 10:81677237-81677259 CACGGGAAAGAAATGTAGGCTGG + Intergenic
1071457600 10:85862871-85862893 CAGAGGGAGGAAATGGAGGGAGG + Intronic
1071964507 10:90838489-90838511 GTGGAGAATGAAATGGAGGAGGG - Intronic
1072208639 10:93226221-93226243 CATGGGGATGAATTGAAGGATGG + Intergenic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1072870196 10:99111073-99111095 AAGGGTAATTCAATGGAGGAAGG - Intronic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073073347 10:100808585-100808607 CTGGGGTATGAAATTGGGGAGGG - Intronic
1073146556 10:101285378-101285400 GAGGGGATGAAAATGGAGGATGG - Intergenic
1073680579 10:105699147-105699169 CAGAGGGATGAAAGGAAGGAGGG + Intergenic
1074245877 10:111692143-111692165 CAGGGGAATAGAATTGAAGATGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075102644 10:119517144-119517166 CTGGGGCATGAAAGGAAGGAAGG + Intronic
1075194328 10:120341875-120341897 CAGGCCAATGAAATGGTAGAGGG + Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1076038304 10:127220294-127220316 CAGGAGAATGAAGAGGAGGCAGG + Intronic
1077100688 11:821028-821050 CAGGGTGATGCACTGGAGGAGGG + Intronic
1077973331 11:7219722-7219744 GTGGGAAATGAATTGGAGGAGGG + Intergenic
1078059756 11:8035579-8035601 CAGTGGGATGGAATGAAGGATGG - Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078197225 11:9146010-9146032 GAGAGGAGTGAAATTGAGGAGGG - Intronic
1078562559 11:12385905-12385927 ATGGGGAATAAAATGGAGGATGG - Intronic
1078633021 11:13021739-13021761 CAGATAAATGAAATGGAGAATGG - Intergenic
1078707684 11:13760769-13760791 AAGGGGAAAGCAATGGAGCAAGG + Intergenic
1082181106 11:49120862-49120884 CAGGGAAATGGAAGGAAGGAAGG - Intergenic
1083026843 11:59558337-59558359 AGAGGGAATGAACTGGAGGAGGG + Intergenic
1083040999 11:59687392-59687414 GAGGGGAAGGAAATGAGGGAAGG + Intergenic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084489246 11:69469407-69469429 CAGGGGGAAGACATGAAGGAAGG + Intergenic
1084678261 11:70649505-70649527 CTGGCAAATGAACTGGAGGAAGG - Intronic
1084785672 11:71440450-71440472 CAGGTGGATGAGATGGATGATGG + Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1086392762 11:86382325-86382347 CAGAGGAATGCAATGAATGAGGG + Intronic
1086415104 11:86581054-86581076 CAGGGGAATAAAATACAGCAGGG + Intronic
1086473018 11:87137381-87137403 GAGAGGAAGGAATTGGAGGAAGG + Intronic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1086939310 11:92779053-92779075 CAGGGGGATGAAAAGGTTGAAGG + Intronic
1086989852 11:93291003-93291025 GACAGGAATGAGATGGAGGATGG + Intergenic
1087219869 11:95535273-95535295 CAGTGGAAGGAAATGGGTGAAGG + Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087867642 11:103251683-103251705 CAGGGGAATGAAGGAGGGGATGG - Intronic
1087870121 11:103283480-103283502 CAGGGGAAGGAACGGAAGGATGG - Intronic
1087920627 11:103862738-103862760 AAGAGGAATGAAAAGAAGGAGGG - Intergenic
1088228521 11:107648275-107648297 GAAGGTAATGACATGGAGGAGGG - Intronic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1088910990 11:114192457-114192479 CAGGGGACTAAAGTGGAAGAAGG + Intronic
1089085365 11:115812584-115812606 CAAGAAAATGGAATGGAGGAAGG - Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1090899336 11:131013559-131013581 CAGAGGAATGACATGGTGGTGGG + Intergenic
1091541352 12:1465656-1465678 CAGGGGAGTCAAGTGGAGAATGG - Intronic
1093108409 12:15118135-15118157 CAAGGGAAGGAAATGGGGGAGGG - Intronic
1093706053 12:22276017-22276039 CAGGGGAATGATATGGAGGGAGG + Intronic
1093866380 12:24232077-24232099 CAGGTGAATGAAAGGCAAGATGG - Intergenic
1094327980 12:29260611-29260633 CAGGGGAGTGAAGAGTAGGAAGG + Intronic
1094627146 12:32135042-32135064 GAGGGGAATGGAGGGGAGGAGGG - Intronic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1096201860 12:49689609-49689631 AAGGAGGCTGAAATGGAGGACGG + Intronic
1096228786 12:49886002-49886024 GAGGGGGCTGAAATGGGGGAAGG - Intronic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096707435 12:53431152-53431174 GGGGGGAATGACAGGGAGGAAGG - Intronic
1097168091 12:57096368-57096390 CAGGGGAATGATAGAAAGGAAGG + Exonic
1097469891 12:59976380-59976402 CAGGAGAATGAAATAGAGACAGG - Intergenic
1098102012 12:67027931-67027953 GAGGGGAAGGAATTGGAAGAGGG + Intergenic
1098194605 12:67986369-67986391 GAAGGGAATGAGATGGCGGAGGG + Intergenic
1098510349 12:71306036-71306058 GAGGGGAGGGAAATAGAGGACGG - Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099195270 12:79608299-79608321 CAGGGGGATGGCAGGGAGGATGG + Intronic
1099246975 12:80203684-80203706 GAGGGGAAAGAAACAGAGGATGG - Intergenic
1100213567 12:92423999-92424021 CAGAGGAAGGAAATAAAGGAGGG + Exonic
1100263899 12:92957868-92957890 CAAGGGACTGAAATGAAGGAAGG - Intergenic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1102623598 12:114216694-114216716 GGGAGGAATGAAAGGGAGGAAGG + Intergenic
1103032748 12:117630591-117630613 GTGGGGAATGAATTGGAAGAAGG + Intronic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103314494 12:120041604-120041626 CAGAGGAAAGGAATGGAGGGCGG + Intronic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1104725087 12:131070969-131070991 CAGGGGAATGTAAGAGAGGCTGG + Intronic
1105034771 12:132910703-132910725 AAGGGCAATGCAATGGAGAAAGG - Intronic
1106281582 13:28278188-28278210 CTGGGGTATGAATTGGGGGATGG + Intronic
1106346412 13:28883631-28883653 CAGGGGTATGGAATGGGGGAGGG + Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107041135 13:35948912-35948934 GAGAGGAGTGAAATGGAGGGTGG - Intronic
1107999993 13:45897180-45897202 GAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1108581714 13:51833686-51833708 CAGGGGAATGAACTGGAGTATGG + Intergenic
1108853832 13:54768883-54768905 CAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1110606818 13:77442564-77442586 CAAATTAATGAAATGGAGGAAGG - Intergenic
1110717306 13:78720976-78720998 TAGGGGAAGGAAAAGAAGGAGGG + Intergenic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1112217850 13:97453364-97453386 AAGGGGAATGGAAGGAAGGAGGG - Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1113109578 13:106807884-106807906 TAGGTGAAGGGAATGGAGGAAGG - Intergenic
1113289616 13:108890409-108890431 CAGGGACATGCACTGGAGGATGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114971120 14:28029906-28029928 CAGGGGTATAGAGTGGAGGAGGG + Intergenic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1115831222 14:37344280-37344302 CAGGGGAATAAAAAAGATGAAGG - Intronic
1116374968 14:44187421-44187443 TAGAGGAAAGAAATGGGGGAGGG - Intergenic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1117387032 14:55225761-55225783 GAAGGGAATAAAATAGAGGAAGG - Intergenic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1117641930 14:57809264-57809286 GAGGCAAATGAAATGGGGGAGGG - Intronic
1118453766 14:65927292-65927314 CAGAGAAATGAAATCTAGGATGG - Intergenic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1118523288 14:66611787-66611809 CAGGGCAATGATAGGGAGAATGG - Intronic
1118567548 14:67158415-67158437 GGGGAGAATGAATTGGAGGAGGG + Intronic
1119013071 14:71017288-71017310 CAGATGAATGAAATGGAGAAAGG + Intronic
1119045360 14:71314213-71314235 CAGGGGAACTACATGGTGGATGG + Intergenic
1119124219 14:72110550-72110572 GAGGGGAATGGAAAGGAAGAAGG - Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119491603 14:75038948-75038970 CAGGAGAATGGCATGGAGGCAGG - Intronic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1119995488 14:79248885-79248907 CAGGGGAGGGAAATGCAGGTGGG + Intronic
1120615642 14:86700713-86700735 CAGATGAATGGAATGGGGGAGGG - Intergenic
1121145068 14:91575927-91575949 CAAAGGAATGAAATACAGGAAGG - Intergenic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121593380 14:95137543-95137565 AAGGGGAAGGGAATGGAGAAGGG + Intronic
1121970910 14:98354949-98354971 CAGGGGAATTAAACGGGAGACGG + Intergenic
1122149422 14:99716970-99716992 CAGGTGAAAGGCATGGAGGAAGG + Intronic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1123061107 14:105594892-105594914 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1123085562 14:105715803-105715825 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1202844562 14_GL000009v2_random:156240-156262 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1202913952 14_GL000194v1_random:146484-146506 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1124624276 15:31299176-31299198 CAGGGGAATGCAGGGAAGGAGGG + Intergenic
1124635385 15:31361572-31361594 CAGGGGGAGGAAATGAAGGCTGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125917860 15:43505449-43505471 CAGGCTAATGAAATGGATAAGGG + Intronic
1126320674 15:47419451-47419473 AGGGAGAATGAACTGGAGGATGG + Intronic
1126383947 15:48074996-48075018 TAGGGGAATGGAGTGGGGGACGG - Intergenic
1126937093 15:53722754-53722776 AAAGGGAAGGAAATGGAGAAGGG + Intronic
1127070233 15:55281731-55281753 AGGGGGAATGGAAGGGAGGAAGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127582339 15:60349830-60349852 GAGGGGAAGGAAAGGGAGGGAGG + Intronic
1127722000 15:61712085-61712107 GAGGAGAATGAAATCGGGGAGGG + Intergenic
1127818732 15:62636677-62636699 CAGGGGAAGGAAGTGGAGCTAGG + Intronic
1128374638 15:67066162-67066184 CGGGGGAGTGAAAGGCAGGATGG - Exonic
1128849926 15:70944066-70944088 CATGGGAAAAAAATGGAGCATGG - Intronic
1129652741 15:77503126-77503148 CATGGGGATGAACTGGAGGGAGG - Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1131092377 15:89632457-89632479 GAGTGAAATGAATTGGAGGATGG + Intronic
1131111925 15:89769956-89769978 CAGGGGAACCAAATGAAGGGTGG + Intronic
1131791459 15:95970209-95970231 AAAGGGAAGGAAAGGGAGGAGGG + Intergenic
1202954746 15_KI270727v1_random:69252-69274 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134869358 16:17637913-17637935 CACTGAAATGAAAGGGAGGAAGG + Intergenic
1135357363 16:21780661-21780683 CATGGGAAAAAAATGAAGGAGGG - Intergenic
1135455867 16:22596777-22596799 CATGGGAAAAAAATGAAGGAGGG - Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135788847 16:25375030-25375052 CAGAGGAATAAAATGCAGGAAGG - Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1135965005 16:27028337-27028359 CAGGGGAATCAAATCTAGAATGG + Intergenic
1137235804 16:46616557-46616579 CAAAGGGAGGAAATGGAGGAGGG + Intronic
1138451810 16:57097788-57097810 CAGGGGACTCCCATGGAGGAGGG - Intronic
1138875480 16:60943409-60943431 CAGAGGAAAAAAATGGAGGCGGG + Intergenic
1139315959 16:66069002-66069024 TAGGGGAATGAATGGGTGGATGG + Intergenic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139532324 16:67548433-67548455 CTTGGGCAAGAAATGGAGGATGG + Intergenic
1139946301 16:70644798-70644820 AGGAGGAATGAAAAGGAGGAAGG + Intronic
1139958903 16:70706449-70706471 CTGGGGATGGAAATGAAGGAAGG - Intronic
1140037531 16:71382647-71382669 AAGGGGAATGGAAGGGAGGTGGG + Intronic
1140169852 16:72593314-72593336 GGGGGGAATGAAATGGGGTAAGG + Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1140283228 16:73574768-73574790 CAGGAGAATGACGTGGATGAAGG - Intergenic
1140332319 16:74070042-74070064 CAGGGGAATGCAAGCTAGGACGG - Intergenic
1140333051 16:74076386-74076408 CAGGAGGAGGGAATGGAGGATGG + Intergenic
1140406486 16:74714530-74714552 AAGGGGAAGGAGATGGAGGTGGG - Intronic
1140604537 16:76518849-76518871 CAGAGGCAGGAAATGGCGGAGGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141204922 16:81926146-81926168 CAGGGGCATGATAGGGACGACGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141890307 16:86922091-86922113 AAGGGGAAGGAAAGGGAAGATGG + Intergenic
1142177422 16:88651507-88651529 CAGGGGGAGGAAATGGGGGCTGG - Intergenic
1142261495 16:89044572-89044594 CAGGGGAAGGGAATGGAGGGGGG - Intergenic
1142349214 16:89572041-89572063 TGGGGGAAGGAAGTGGAGGAAGG + Intergenic
1142358077 16:89613522-89613544 AAGAGGAGGGAAATGGAGGAGGG - Intronic
1203141842 16_KI270728v1_random:1771910-1771932 CCTGGGATTGAGATGGAGGAAGG - Intergenic
1142805058 17:2367178-2367200 AAGGGGAGTGGAATGGAGGCCGG - Intronic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1143513451 17:7408028-7408050 AAGGGGAAGGAAATGGGAGAAGG - Intronic
1143729345 17:8872052-8872074 GAGGGTAAAGAAATTGAGGAGGG - Intergenic
1144003043 17:11073360-11073382 GAGGGGAAAGTAATGGCGGAGGG - Intergenic
1144197071 17:12904823-12904845 GAGGGGAATGAAGTGGTTGAGGG + Intronic
1144258005 17:13488915-13488937 AACTGGAATGAAATGAAGGAAGG + Intergenic
1144797610 17:17903007-17903029 CAGGTGGATGAAGGGGAGGAAGG - Intronic
1145046494 17:19621536-19621558 CTGGGGAATGAAATGTCTGAGGG - Intergenic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146728229 17:35172868-35172890 CAGAGGAATGAAATAAAAGACGG - Intronic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1147438529 17:40432473-40432495 GAGGGCAATGGACTGGAGGATGG - Intergenic
1147844136 17:43393104-43393126 CAGGGAAATGAAGTGAAAGATGG - Intergenic
1149349370 17:55771743-55771765 CAGTTGAATGAAATGTAGGGAGG + Intronic
1149502201 17:57162030-57162052 CAGGGCAATTAAATGGGGGCTGG - Intergenic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1151022303 17:70631489-70631511 CAGAGGAATGAATTAGAAGAGGG + Intergenic
1151310509 17:73289759-73289781 GAGGGGAAGGAAAGGAAGGAAGG + Intronic
1151483654 17:74385147-74385169 CAGGGGAAGGAAAAGGAAAAGGG + Intergenic
1151594052 17:75066058-75066080 CAGTAAAATGAAAGGGAGGAGGG - Intergenic
1151793517 17:76325696-76325718 CAGGAGAATGGCATGGAGGCAGG - Intronic
1151892720 17:76960200-76960222 CAGAGGAATGAGATACAGGAAGG - Intergenic
1152448513 17:80361213-80361235 CAGTGGAATAAAATAAAGGAAGG - Intronic
1152501924 17:80717838-80717860 CAGGGGAATGCAAGGGAGGGCGG - Intronic
1153287039 18:3466203-3466225 CAAGGAAATGGAATGGGGGAGGG - Intergenic
1153322381 18:3785829-3785851 CAGAGGATTGAAAGGGAGCAGGG + Intronic
1154065358 18:11102488-11102510 CAGGGGAAGGAAAGGGAATAAGG - Intronic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154447520 18:14447706-14447728 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1155343109 18:24832547-24832569 CAGGGGATTAAAATAGAGAAGGG + Intergenic
1155883036 18:31173872-31173894 TTGGGGTATGAAAGGGAGGAAGG + Intergenic
1156184468 18:34645627-34645649 CAGGTGGATGAAATGGAGAGGGG + Intronic
1156883153 18:42104438-42104460 CTGGAGAATGAATTGGAGGAAGG - Intergenic
1157367692 18:47081014-47081036 GAAGGGAAGGAAAGGGAGGAGGG - Intronic
1157738829 18:50074262-50074284 CAGGGGAAGGTAATTGAGCATGG - Intronic
1158252115 18:55500336-55500358 CAGGGGAAAGGAGTGGAGGAGGG + Intronic
1158441542 18:57479104-57479126 CAGGGGAAGGAAAGGGAGTGAGG + Exonic
1158758534 18:60355943-60355965 ATGGGGAAAGAAATGGAGGGAGG - Intergenic
1159376106 18:67595723-67595745 CAGGAGCATGAAATGGGGAAAGG - Intergenic
1159851252 18:73529340-73529362 CAGGGCTGTGCAATGGAGGATGG + Intergenic
1160075233 18:75668081-75668103 CAGAGGAAGGAAGTGAAGGAAGG + Intergenic
1160770912 19:830685-830707 CTGGGGAAGGAAATGGAGTCAGG - Intronic
1161100528 19:2419001-2419023 GAGGGGAAGGAAAGGGAGGGAGG - Intronic
1161690116 19:5727483-5727505 CAGGGGCTGGAATTGGAGGAAGG + Intronic
1162525285 19:11203153-11203175 CAGGGGAATGCCATGGAACAAGG - Intronic
1162660677 19:12166390-12166412 CAGGGAAAAGAAATGGGGGTGGG + Intronic
1162828599 19:13269993-13270015 CAGGGGAAGGGAATAGGGGAAGG - Intronic
1163351361 19:16777968-16777990 AAAGGGAAGGAAATGGAGGAAGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164797271 19:31044255-31044277 TAGGTGGATGAATTGGAGGAAGG + Intergenic
1165081508 19:33309793-33309815 GCGGGGAATGGAATAGAGGATGG - Intergenic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1166350305 19:42194946-42194968 GAAGGGAAGGAAATGAAGGAGGG + Intronic
1166631617 19:44412059-44412081 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1166636559 19:44456562-44456584 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1166771790 19:45287725-45287747 CTGGGGAATGAGATGAAGGCAGG - Intronic
1166966015 19:46529621-46529643 AAAGGGAAAGAAAGGGAGGAAGG + Intronic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1167616225 19:50535760-50535782 CAGGAGGATGAATGGGAGGAGGG - Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1168189347 19:54726557-54726579 CAGGGGACTGAAGAGGAAGATGG + Intronic
1168199630 19:54805293-54805315 CAGGGGACTGAAGGGGAAGATGG + Intronic
925171669 2:1754044-1754066 CAGGGGAGTGAAATGGAACCAGG + Intergenic
925530800 2:4860103-4860125 CAGGGGTTTGAAACAGAGGAAGG + Intergenic
925682032 2:6432516-6432538 CAGGGGAATGACATGAACCAGGG + Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
925873788 2:8294225-8294247 CAAGTGAATGTAAAGGAGGATGG - Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926128294 2:10285211-10285233 CAGGGGTTTATAATGGAGGAGGG + Intergenic
926630669 2:15133331-15133353 CAGGGAAGTGAAATGAAGAAAGG + Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926918860 2:17919280-17919302 TAGGGGAAGGAAGTGGGGGAAGG + Intronic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928773735 2:34733320-34733342 AAGGGGAACGAAAGGAAGGAAGG - Intergenic
928931683 2:36631624-36631646 AAAAGGTATGAAATGGAGGATGG - Intronic
929094556 2:38251113-38251135 TATGGAAATGAAAGGGAGGAAGG + Intergenic
929278197 2:40048360-40048382 TAAGGGAAAGAAATGCAGGAAGG + Intergenic
929414905 2:41737404-41737426 GTAGGGAATGAAATGGAGGCTGG - Intergenic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929956806 2:46464383-46464405 CATGGGAATGAGATGGACCATGG - Intronic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
931905576 2:66839191-66839213 CAGGAGAATGTAATCCAGGAGGG + Intergenic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
933041493 2:77472835-77472857 CTGGTGAATGAAATAAAGGAAGG + Intronic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
933794277 2:85907167-85907189 CAGTGGAATGGAGTTGAGGAGGG + Intergenic
934603168 2:95673933-95673955 CAGGGTCATGTAATGGGGGAGGG + Intergenic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
935874791 2:107494749-107494771 CAGAGGAAAGAAAGAGAGGAAGG + Intergenic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
936630356 2:114195509-114195531 TAGGTAAATGAAATGGAAGATGG - Intergenic
937206111 2:120238146-120238168 CAGGGGACTGAGATAAAGGAAGG - Intergenic
937299986 2:120833145-120833167 CAGGGAAAGGAAATGCAGGAGGG - Intronic
938184580 2:129218450-129218472 CTGGGGAGGGAAATGGAGCAGGG - Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938541390 2:132286616-132286638 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
939423448 2:142003640-142003662 CAGAGTAATGAAATGCAGGCAGG + Intronic
939771593 2:146326719-146326741 GAGAGGAAAGACATGGAGGAGGG + Intergenic
940037877 2:149329828-149329850 CAGGGGCTTTAACTGGAGGAAGG + Intergenic
940159181 2:150693334-150693356 GAAGGGAATGAAGGGGAGGAAGG - Intergenic
940340728 2:152578051-152578073 CGAGGGAATGGGATGGAGGAAGG + Intronic
940662036 2:156558352-156558374 CAGGGCAATGAAGTGGCTGATGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941464664 2:165812006-165812028 GAGGTGAATGAAAGGGAAGAAGG + Intergenic
941862685 2:170300343-170300365 TAGAGGACTGATATGGAGGAAGG + Intronic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942455023 2:176131480-176131502 CAGGAGAATGAAATGGAAAAAGG + Exonic
943793681 2:191965232-191965254 CAGGGGAAGGAAGTGGGAGAAGG - Intronic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
945041277 2:205745670-205745692 AAGGGGAAGGAAAGGGAAGAAGG + Intronic
945571627 2:211474804-211474826 GAAGGGAAGGCAATGGAGGATGG + Intronic
945995440 2:216432368-216432390 CAGGGGACGTACATGGAGGAGGG - Intronic
946409510 2:219509154-219509176 GAGGGGATTGAGATGGAGGTGGG - Intergenic
946978148 2:225176012-225176034 GAGTGAAAAGAAATGGAGGATGG + Intergenic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948998316 2:241596049-241596071 CAGCGGAAGGACATGGAGCACGG - Intronic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171870291 20:30519638-30519660 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1172012098 20:31851506-31851528 CAGGGCAATGAAACTGAAGATGG + Intronic
1172224628 20:33297215-33297237 CATGAGAGTGAAATGGAGGCTGG - Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1173142206 20:40494337-40494359 CAGAGGAATGAAAGGGAGGGAGG - Intergenic
1173346556 20:42205731-42205753 CTGGAGATTGCAATGGAGGATGG - Intronic
1173868068 20:46325407-46325429 CAGGGGCATGAAATGGAGCCAGG - Intergenic
1174429322 20:50456418-50456440 CAGGGGACTACAATGGAGAATGG + Intergenic
1174653004 20:52144614-52144636 GAAATGAATGAAATGGAGGAGGG + Intronic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175657831 20:60787111-60787133 GAGGGGGATGAAGAGGAGGAGGG - Intergenic
1175678912 20:60970372-60970394 CAGTGGAAGGAAATGCACGAGGG - Intergenic
1175940431 20:62535235-62535257 CATGGGGAAGAAATGCAGGAGGG + Intergenic
1176603224 21:8811103-8811125 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1176612092 21:8992473-8992495 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1176633307 21:9161158-9161180 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1176640015 21:9293659-9293681 CATGGGAAAGGAATGTAGGAGGG - Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1177988741 21:28012127-28012149 CAGGGGAATAGAGTGGGGGAGGG - Intergenic
1178082982 21:29084572-29084594 CAGGGGAATAAAATCAAGGGAGG + Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179716864 21:43292964-43292986 GAAAGGAAGGAAATGGAGGAGGG - Intergenic
1180345510 22:11702660-11702682 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1180352208 22:11814652-11814674 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1180353275 22:11820901-11820923 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1180424062 22:12901122-12901144 CATGGGAAAGGAATGTAGGAGGG - Intergenic
1181148346 22:20864798-20864820 CTGGGGAAGGAAAGGAAGGAGGG + Intronic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181536813 22:23550571-23550593 CAGAGGAATAAATAGGAGGATGG - Intergenic
1181537006 22:23551566-23551588 CAGAGGAATGAATTGGAGGATGG - Intergenic
1181537115 22:23552143-23552165 CAGAGGAATGAATGGGAGGATGG - Intergenic
1181537137 22:23552274-23552296 CAGAGGAATGAATGGGAGGATGG - Intergenic
1182048972 22:27298872-27298894 GAGGGGAGAGAAATGGAGAATGG + Intergenic
1182333968 22:29570802-29570824 AAGGGGGATGAAGTGGAGGCAGG - Intronic
1182555441 22:31126279-31126301 CTGGGGAACTAAATGGAGGCAGG - Intronic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183354521 22:37351088-37351110 CAGGGGACCGCAAGGGAGGAGGG - Intergenic
1183483320 22:38076470-38076492 CAGGGGTGGGACATGGAGGAGGG + Intergenic
1183501375 22:38181597-38181619 CAGGGGGATGAAAAGATGGAAGG + Intronic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1184964845 22:47963889-47963911 CAAGAGAATAAAATGGAGGGCGG - Intergenic
1203314469 22_KI270736v1_random:173634-173656 GAATGGAATGAAGTGGAGGAAGG + Intergenic
949736463 3:7177643-7177665 GAAGGGAATGAAATGCAGGGAGG + Intronic
950621526 3:14209500-14209522 CAGGGGAGTGTAATGGAGGAGGG - Intergenic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951967175 3:28399520-28399542 CAGGGGGATGAAATGGACTCTGG - Intronic
952003059 3:28808976-28808998 CAGGGAAATGATATGGGAGAAGG - Intergenic
952032713 3:29163565-29163587 CAGGGGAAAGCACTGGAAGAAGG - Intergenic
952509209 3:34036956-34036978 TAGTGTTATGAAATGGAGGAAGG + Intergenic
952528204 3:34235722-34235744 TAATGGAATGAAAGGGAGGAGGG - Intergenic
952971981 3:38657088-38657110 CAGTGGAATGCAATGGAACATGG - Intergenic
953472130 3:43176721-43176743 CGGAGAAAGGAAATGGAGGAAGG + Intergenic
953975230 3:47377193-47377215 CAGGGGAAGGAAAGGCAGTAGGG + Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954922848 3:54206722-54206744 CAGGAAAAGGAAATGCAGGAAGG - Intronic
955059551 3:55483680-55483702 CAGAGGAGTGAGGTGGAGGAGGG + Intronic
955615732 3:60804771-60804793 CAGGGCTGTGCAATGGAGGAAGG - Intronic
956118775 3:65944974-65944996 ATGGGGCATGAAATAGAGGACGG + Intronic
956216519 3:66855151-66855173 CAGGGGATTGAACTGGGGGAAGG - Intergenic
956749326 3:72333714-72333736 CAGGGGACTCCAAAGGAGGAGGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957523519 3:81351212-81351234 GAGGGGAATGATATAGAGGAAGG - Intergenic
957729680 3:84117587-84117609 CAAGGAGATGAAATGGATGAAGG - Intergenic
957823481 3:85409648-85409670 CAAGGGAAGGGAATGGAGGCAGG + Intronic
958552684 3:95637202-95637224 CTGGGGTATGAAAGGGAGCAGGG - Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959667833 3:108941516-108941538 CAGGGGAATGAAATGGAGGAGGG - Intronic
961573470 3:127816801-127816823 CAAGGGAAGGAACTGCAGGAGGG + Intronic
963530804 3:146470714-146470736 AAAGGGAATGGAAGGGAGGAAGG + Intronic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
963687881 3:148460870-148460892 CAGGGGAGTGAAATGGACTTTGG + Intergenic
964132044 3:153300304-153300326 CAAAGAAATTAAATGGAGGAAGG + Intergenic
964612244 3:158627112-158627134 CAGGGGTATTAGGTGGAGGATGG + Intergenic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
966128853 3:176611969-176611991 CCAGGGATTGAAGTGGAGGAGGG + Intergenic
966210894 3:177452415-177452437 GAGGGGAAAGAAAGGGAGGGAGG - Intergenic
967356537 3:188578229-188578251 CAAGGGAATGAAAGGAAGGAAGG - Intronic
967690922 3:192472645-192472667 CAGAGGAATGAAGAGTAGGAAGG + Intronic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
967961367 3:194927926-194927948 GAGGGCAGTGAGATGGAGGAGGG - Intergenic
968229035 3:196993757-196993779 CAGTGGAATGCAATGGATGATGG - Intronic
1202746879 3_GL000221v1_random:111363-111385 CATGGGAAAGGAATGTAGGAGGG + Intergenic
968773742 4:2526031-2526053 CAGGAGAATGGCATGGAGGCAGG + Intronic
969581899 4:8070766-8070788 CTGGGGAAGGAAAGAGAGGAGGG + Intronic
969920060 4:10530026-10530048 AAGGTGAAAGAAAGGGAGGAAGG - Intronic
970839567 4:20451188-20451210 CAGTGGAATGAACTTCAGGAAGG - Intronic
971359362 4:25922634-25922656 CTGGGGAATGAAATGTATGAAGG - Intronic
971596834 4:28540281-28540303 AAGGGGAAAGAAAGGTAGGAGGG - Intergenic
972428062 4:38953764-38953786 CAAGGCAATGGGATGGAGGAAGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972909388 4:43796372-43796394 CTTGGGAATGAAATGAAGGCTGG - Intergenic
973374852 4:49279548-49279570 GAGGTGAAAGAAATGGTGGAGGG + Intergenic
973375756 4:49285570-49285592 GAGGTGAAAGAAATGGTGGAGGG + Intergenic
973376657 4:49291589-49291611 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
973377576 4:49297741-49297763 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
973378495 4:49303877-49303899 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
973380567 4:49317626-49317648 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
973381654 4:49324671-49324693 GAGGTGAAAGAAATGGTGGAGGG - Intergenic
973382559 4:49330693-49330715 GAGGTGAAAGAAATGGTGGAGGG - Intergenic
974331855 4:60489701-60489723 AATGGGAATGAAAGAGAGGAGGG + Intergenic
974926919 4:68310795-68310817 CAGGGGCATGGAATTGAAGAAGG - Exonic
975015733 4:69416012-69416034 CAGCGGAAGGAAATATAGGAAGG + Intronic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
975736078 4:77382530-77382552 CCGGGGACAGAAATTGAGGAGGG + Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977870165 4:102081605-102081627 GAAGGGAAGGAAAGGGAGGAAGG + Intergenic
977993452 4:103473798-103473820 TAGGGGAAGGAAAGGGAGGTGGG - Intergenic
978413893 4:108455386-108455408 CAGAAGAATGTCATGGAGGAGGG - Intergenic
978825917 4:113023378-113023400 CAAGGGAATGGACTGGAGGGTGG - Intronic
979093889 4:116519997-116520019 CAGGAGAATGAAAGAGAAGAAGG + Intergenic
979972907 4:127159677-127159699 AAGGGGAAGGAAAGAGAGGAAGG + Intergenic
980427066 4:132639490-132639512 CATGGGAAAGAAATGTAGGCTGG - Intergenic
980774966 4:137425827-137425849 CAGGTGAAAGAACTGGAGAAGGG - Intergenic
980881060 4:138710259-138710281 CTGGGTAATGTAATGGAGGCTGG - Intergenic
981251836 4:142612123-142612145 CAGGAGAAAAAAATAGAGGAAGG + Intronic
981261957 4:142731124-142731146 CAGGGGAATGGGGTGGGGGAAGG - Intronic
981561350 4:146051543-146051565 CATGTGATTGAAATGGAGAAAGG + Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982031277 4:151303573-151303595 CTGGGGAGTGGAATCGAGGAGGG - Intronic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983438942 4:167755858-167755880 CAGAGGAAGAAAATGAAGGAAGG - Intergenic
983795156 4:171853347-171853369 AAGGGGAAAGAAGGGGAGGAAGG - Intronic
984610697 4:181833653-181833675 GAGCAGAATGAAATGCAGGAAGG - Intergenic
984869817 4:184316169-184316191 AAAGGGAAGGAAATGGAGAAAGG - Intergenic
984876916 4:184377112-184377134 CAAGTGATTGGAATGGAGGATGG - Intergenic
984967016 4:185148520-185148542 AAGGGAAATGAAATGGGGGGAGG + Exonic
1202754909 4_GL000008v2_random:52065-52087 CATGGGAAAGGAATGTAGGAGGG - Intergenic
985547121 5:515312-515334 CAGGGGCCTGAAAGGAAGGAGGG - Intronic
985864428 5:2503229-2503251 CAGGGGAGGGAATTAGAGGAGGG - Intergenic
986468391 5:8050063-8050085 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
986522363 5:8633359-8633381 AAGGGGAAGGAAGTGGGGGAGGG - Intergenic
987147370 5:15005450-15005472 AAGGAGAAAGAAATGAAGGAAGG - Intergenic
987546961 5:19322984-19323006 CAGAGGAGTAAAATAGAGGATGG + Intergenic
988588980 5:32532570-32532592 GAGGGGAAGGTAATGGAGAAGGG + Intronic
989128812 5:38083679-38083701 CAGGGGAATGTCTTGGAGGAAGG - Intergenic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
990608908 5:57438044-57438066 CAGGAAAATGAACTGGAGGAAGG + Intergenic
991153198 5:63396942-63396964 CAAGGGAAAGAAGTAGAGGATGG + Intergenic
991493941 5:67209820-67209842 CAGGGGAATGAATGGCCGGATGG + Intergenic
991646735 5:68808154-68808176 GAAGGGAAGGAAAGGGAGGAAGG + Intergenic
991738000 5:69644500-69644522 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991760194 5:69911924-69911946 CCGGGGCAGGAAATGGAGGGAGG + Intergenic
991787138 5:70206176-70206198 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991789576 5:70224226-70224248 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991814325 5:70499336-70499358 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991817460 5:70520628-70520650 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991839425 5:70786975-70786997 CCGGGGCAGGAAATGGAGGGAGG + Intergenic
991879584 5:71206566-71206588 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991882024 5:71224595-71224617 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
995060615 5:107808550-107808572 AAGGGGAAAGAAATCAAGGAAGG + Intergenic
995189148 5:109302371-109302393 CAGGGGTATGATGTGGAGGAGGG - Intergenic
996005027 5:118409246-118409268 GAGAGGAATGAAATTGAGGTTGG - Intergenic
996225574 5:120990630-120990652 CAAGGGAGTGGAATGGAGGGAGG - Intergenic
996382739 5:122878318-122878340 CAGGAGAATGAGGTGGAGAAGGG + Intronic
996890320 5:128411358-128411380 CACGTGAATGAATTGAAGGATGG + Intronic
997258318 5:132446011-132446033 CAGGGGATTTCAAGGGAGGATGG + Intronic
998058742 5:139102631-139102653 GAGGGGAAGGAATGGGAGGAGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998555382 5:143118178-143118200 CAGAGGAATGATATGGACAAAGG + Intronic
998699381 5:144680349-144680371 AGGGGGAAGGAAATGAAGGATGG + Intergenic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999593209 5:153171912-153171934 CAGGGAACTGAAATGGAGCCTGG + Intergenic
999683880 5:154085117-154085139 TAGGGAGATGAAATGGAGAAAGG + Intronic
999872323 5:155765400-155765422 GAGGGGAAGGAAGTGAAGGAAGG + Intergenic
1000199908 5:158997970-158997992 GAGGGGAAGGAAATGGTGGCAGG - Intronic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1001288913 5:170442794-170442816 CAGGGGACAGGAATGGAGGCAGG + Intronic
1001690016 5:173625945-173625967 CAGAGCACTGAAATGGAGGTAGG - Intergenic
1002167875 5:177359339-177359361 CATGGGAATGCAAGGGAGGTGGG - Intronic
1002427552 5:179185184-179185206 CAGTGGGAGGACATGGAGGAAGG + Intronic
1002477002 5:179472744-179472766 CGGGGGAATGACATGGAGTTTGG - Intergenic
1003516050 6:6819550-6819572 CAGGGGTTAGATATGGAGGAGGG + Intergenic
1004092634 6:12519848-12519870 GAGGGGAATGGAATTTAGGATGG - Intergenic
1004954863 6:20718198-20718220 CAGGGAAATGAACTGGAAAATGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005024023 6:21445704-21445726 AAGGGGAAAGAAAGGAAGGAGGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1006283838 6:33078168-33078190 CTGGGCAGTGAAAGGGAGGACGG + Intronic
1006731873 6:36242362-36242384 GAAGGGAAGGAAATGAAGGAAGG - Intergenic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007361031 6:41355941-41355963 CAGGGGCAGGACATGGAGTAGGG - Intergenic
1007387830 6:41531409-41531431 CAGGTGAGAGAACTGGAGGAGGG - Intergenic
1007786089 6:44280128-44280150 CAGGGGTATGAAATGAGGGATGG + Exonic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1009957056 6:70468473-70468495 CATGGGAGTGACATGGAGGCAGG - Intronic
1010327174 6:74577851-74577873 CAGGTGAATGGCCTGGAGGAAGG + Intergenic
1010372777 6:75130816-75130838 CAAGGGAATGGAATGGAGAAAGG + Intronic
1010488530 6:76446580-76446602 CAGGGGTAGGGAATGGAAGAGGG + Intergenic
1012004809 6:93700030-93700052 GTGGAGAATGAAATGTAGGAGGG + Intergenic
1012027575 6:94017095-94017117 CTGGGGATTGGAGTGGAGGATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1013551107 6:111208613-111208635 GAGTGGAATGGAGTGGAGGAGGG + Intronic
1013934102 6:115572233-115572255 GAGGAGAATGAAATTGAAGATGG - Intergenic
1014036300 6:116770137-116770159 CAAGGTAATGAAATAGAGGGTGG - Intergenic
1016197721 6:141366442-141366464 CAGGGGGATGGGATGGGGGAGGG - Intergenic
1016446741 6:144140749-144140771 CAAGGGGATGAAATGGATGAAGG + Intergenic
1016726068 6:147369201-147369223 CAAGGCAATGCAATGGAGAAAGG + Intronic
1018779156 6:167046357-167046379 AAGGAAAATGGAATGGAGGAAGG + Exonic
1019016772 6:168885685-168885707 CAGGTGACTGAAAGTGAGGAGGG + Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019736661 7:2653222-2653244 CAAGGGAAAGGAATGAAGGAGGG - Intronic
1019777324 7:2919579-2919601 CTGGTGAAGGACATGGAGGACGG - Exonic
1019926826 7:4198450-4198472 CAGAGGAAGGAAGTGCAGGAGGG - Intronic
1021022026 7:15612569-15612591 CAGGCGGATGAAGTGGAAGAGGG - Exonic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1022448320 7:30489184-30489206 AAAGGGAATTTAATGGAGGAGGG - Intergenic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024603772 7:51008858-51008880 CTGGTGAATGAAAAGGAGGTGGG + Intergenic
1024762124 7:52611351-52611373 AAATGGAATGAAATGGAGGCAGG - Intergenic
1026250119 7:68662664-68662686 TAGAGGAATGATAGGGAGGAAGG + Intergenic
1026850495 7:73720324-73720346 CAAGGTAATGAAATGAAGGAGGG - Intergenic
1028308683 7:89300853-89300875 CAGTGGATAGAAGTGGAGGAGGG + Intronic
1028443563 7:90892671-90892693 CAGGGGAAGGAATCCGAGGAGGG - Intronic
1028832463 7:95342702-95342724 CAGGAGAATGAAAGGGGAGAAGG - Intergenic
1029534130 7:101145906-101145928 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
1030384077 7:108847445-108847467 GAGGGGAATGGAGGGGAGGAGGG - Intergenic
1030942729 7:115674755-115674777 CAGAGGAGTTAAATGAAGGAGGG - Intergenic
1033137384 7:138796696-138796718 GATGGGAATAAAAAGGAGGATGG - Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033354197 7:140586213-140586235 GAGAGGTAAGAAATGGAGGAAGG + Intronic
1033499635 7:141934961-141934983 CAGGGGAATGAAAAGAGGAAAGG - Intronic
1033573159 7:142654322-142654344 CACGGGAATGAAATTGAAAAAGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034198708 7:149267177-149267199 AAGGGGAATGAAGTAGAGGTGGG + Exonic
1034260054 7:149749653-149749675 CAGGGGGATGACAGGAAGGAGGG - Intergenic
1034879549 7:154752859-154752881 CAAGGGAAAGACATGGTGGACGG + Intronic
1035322128 7:158038213-158038235 CAGTGGAATAAAACTGAGGAGGG + Intronic
1035997039 8:4559841-4559863 AAGGGGCATGAAGTGGAGAAAGG - Intronic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036561278 8:9902299-9902321 CAGGTGGAGGAAATGGAGGAGGG - Intergenic
1036604511 8:10293738-10293760 AAGGGGAAGGAAAGGGAGGGAGG - Intronic
1036942569 8:13065612-13065634 CGGGGAAGAGAAATGGAGGATGG + Intergenic
1036971832 8:13364097-13364119 CAGGAGAATGAAAGAGAGAAAGG + Intronic
1037709960 8:21347637-21347659 CAGGGGAGGGACATGGGGGAGGG + Intergenic
1037753516 8:21697286-21697308 CAGAGGGAAGAAATAGAGGAAGG + Intronic
1038987755 8:32831343-32831365 CAGAAGGATGAAGTGGAGGATGG - Intergenic
1038999313 8:32962228-32962250 TAGGGGAATGAGATTGGGGATGG + Intergenic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1040902157 8:52428219-52428241 CAGGGGAGTGAAGTGGAGAGAGG - Intronic
1043147230 8:76673836-76673858 CAGGAGAGAGAAATGGGGGAGGG + Intergenic
1043458037 8:80431602-80431624 CAGGGGAATGAGTTGCAGAAAGG + Intergenic
1045412012 8:101929353-101929375 AAAGGGAATGGAAGGGAGGAGGG + Intronic
1045729447 8:105218293-105218315 CAGGGACATGAAAAGGAGGGAGG + Intronic
1046206723 8:111009489-111009511 CAGGTGAATGACATGGACCAAGG + Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1048083053 8:131149275-131149297 GATGGCAATGATATGGAGGAGGG - Intergenic
1048191343 8:132292582-132292604 CAGAGGAATGAATGGGTGGATGG + Intronic
1048340663 8:133536300-133536322 CATGGGCATTAAAAGGAGGAAGG + Intronic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1049029793 8:140025929-140025951 CTGGGGACGGAAATGGATGATGG - Intronic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1050062250 9:1721727-1721749 AAGGGGAGAGAAATGGAGGGAGG + Intergenic
1051020890 9:12541319-12541341 CAGGGGAATAAAAGGCTGGAAGG + Intergenic
1051959780 9:22744766-22744788 CAAGGTAATTCAATGGAGGAAGG + Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052221797 9:26032944-26032966 CAGGGCAAAGAAATAGAGGCAGG - Intergenic
1052231071 9:26153438-26153460 CAGGGGAAGGAAGGGAAGGAAGG + Intergenic
1052257349 9:26473796-26473818 AAGGTAAAGGAAATGGAGGAAGG - Intergenic
1052548435 9:29912301-29912323 CAAGGTAATGAAATGAAAGACGG - Intergenic
1052588924 9:30465970-30465992 CACAGGAATGAACTGGAGGTTGG - Intergenic
1052992185 9:34525231-34525253 CAGGGGAGGGAAATGGAGGCAGG - Intergenic
1053097550 9:35341650-35341672 CGAGGGAAGGAAATGGAGGAGGG + Intronic
1053182264 9:35982892-35982914 GAGAGGAATGTAATTGAGGAGGG - Intergenic
1055989893 9:82094203-82094225 CAGGGGAGGGAAACAGAGGAGGG + Intergenic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056495989 9:87155714-87155736 TAGGGGGAAGGAATGGAGGAGGG + Intronic
1056801204 9:89693256-89693278 TAGAGGAATGAAATGGATGGTGG + Intergenic
1057091420 9:92261451-92261473 GAGGGGAAGGCAATGCAGGAAGG + Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1058389502 9:104478703-104478725 TAGGGTAATGCAATTGAGGATGG - Intergenic
1058798091 9:108517891-108517913 CAGGGCAATGACATACAGGAGGG - Intergenic
1061244768 9:129395831-129395853 CAGAGGAATGAATGAGAGGATGG + Intergenic
1061245001 9:129397087-129397109 CAGAGGAATAAATAGGAGGATGG + Intergenic
1062134190 9:134916159-134916181 CAGGGTTCTGAAATGGAGGGAGG - Intronic
1203698563 Un_GL000214v1:117653-117675 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203699482 Un_GL000214v1:123804-123826 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203700428 Un_GL000214v1:130087-130109 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203701343 Un_GL000214v1:136107-136129 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203756148 Un_GL000218v1:128786-128808 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1203480174 Un_GL000224v1:4690-4712 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203481141 Un_GL000224v1:11018-11040 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203482105 Un_GL000224v1:17327-17349 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203715515 Un_KI270742v1:141456-141478 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1203535702 Un_KI270743v1:36774-36796 CATGGGAAAGGAATGTAGGAGGG - Intergenic
1203548668 Un_KI270743v1:151047-151069 GAGGTGAAAGAAATGGTGGAGGG + Intergenic
1203549748 Un_KI270743v1:157358-157380 GAGGTGAAGGAAATGGTGGAGGG - Intergenic
1203550688 Un_KI270743v1:163523-163545 GAGGTGAAAGAAATGGTGGAGGG - Intergenic
1203568132 Un_KI270744v1:108798-108820 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203649763 Un_KI270751v1:105032-105054 CATGGGAAAGGAATGTAGGAGGG + Intergenic
1185844617 X:3426192-3426214 AAATGGAAAGAAATGGAGGATGG + Intergenic
1186121545 X:6368400-6368422 GAGGGGAATAAAGTGGATGAGGG - Intergenic
1186287941 X:8065631-8065653 CAGGGGAGGGGAATGGAGGCAGG + Intergenic
1186390214 X:9151227-9151249 CAGGGGAATGTGATGGGGAATGG - Intronic
1187073857 X:15914838-15914860 CAGGAGAAAGAAATGGAAGATGG - Intergenic
1187316768 X:18203126-18203148 TGGGGGAAGGAAAAGGAGGATGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187520923 X:20013147-20013169 AAGGTGAATGAAATGAGGGAAGG + Intronic
1188142836 X:26573700-26573722 AAGGAGAATGAAAAGAAGGAAGG - Intergenic
1189009683 X:37034783-37034805 CAGGGGAAGGAAATGGGGCAGGG - Intergenic
1189461275 X:41244953-41244975 GAAGGGAATGGAATGGAGGATGG - Intergenic
1190339471 X:49285774-49285796 CAAGGGAATGAAGCAGAGGAGGG - Intronic
1190702094 X:52996652-52996674 CAGGGTAGTGAAATAGAAGAGGG + Intergenic
1191666329 X:63706415-63706437 CAGGAGGATGAGGTGGAGGAGGG - Exonic
1191735855 X:64387184-64387206 CAGGGGAAAGAAATGGTCAAGGG + Intronic
1192016525 X:67337574-67337596 CAGGGAAATGGAGTGGAGGTAGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192473509 X:71419773-71419795 CAGGGGGGTGAAATGGGGCAGGG + Intronic
1192476234 X:71445506-71445528 CAGGGCAATTCAATGGAGGAAGG - Intronic
1192491739 X:71581483-71581505 CAAGGGTATGATATGGGGGAAGG + Intronic
1192656447 X:72999816-72999838 TAGAGGAAGGAAAGGGAGGAAGG - Intergenic
1192665673 X:73083185-73083207 TAGAGGAAGGAAAGGGAGGAAGG + Intergenic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1193477954 X:81990214-81990236 AAAAGGAATGAAGTGGAGGAGGG + Intergenic
1194008642 X:88530750-88530772 CAGGGGAAAAAAATGGAGGCGGG - Intergenic
1194686211 X:96920518-96920540 CAGGGAATTGAATTGGTGGAAGG + Intronic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1195979612 X:110563312-110563334 AAGGGGTATGAAATGGATGTGGG + Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1196806628 X:119593742-119593764 CAAGGCAATTCAATGGAGGAAGG + Intronic
1197127424 X:122963838-122963860 CAGGGGGATGAGATTGAGTATGG + Intergenic
1198069941 X:133138423-133138445 CAGGGGACTGAACTGGGGAAGGG - Intergenic
1198212818 X:134531004-134531026 CAGGGGGATGACCTGGAGCAGGG - Intergenic
1198226232 X:134648295-134648317 CAAGGGAATGAAAGGGAAAATGG + Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1200944588 Y:8821318-8821340 CAGGGGAATGAAGTTGTGGTTGG - Intergenic
1201105729 Y:10761971-10761993 GAGGGGAATGGAATGGAGTGTGG - Intergenic
1201120195 Y:10866944-10866966 CAGTGGGATGAAATGAAGTAGGG - Intergenic
1201120715 Y:10870699-10870721 AAGTGGAATGAAATGGAGTCGGG - Intergenic
1201127342 Y:10927060-10927082 CAGTGGAATGAAATGGAGTAGGG - Intergenic
1201925051 Y:19275095-19275117 CAGGGGAAAGACATGGGGGGAGG - Intergenic