ID: 959669836

View in Genome Browser
Species Human (GRCh38)
Location 3:108963986-108964008
Sequence TGTCATTGCCTGTGAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959669836_959669841 5 Left 959669836 3:108963986-108964008 CCAGTAATTCACAGGCAATGACA 0: 1
1: 0
2: 0
3: 11
4: 188
Right 959669841 3:108964014-108964036 GCCCACCACTTGGGGCTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 162
959669836_959669839 -4 Left 959669836 3:108963986-108964008 CCAGTAATTCACAGGCAATGACA 0: 1
1: 0
2: 0
3: 11
4: 188
Right 959669839 3:108964005-108964027 GACAGAATGGCCCACCACTTGGG 0: 1
1: 0
2: 1
3: 6
4: 123
959669836_959669838 -5 Left 959669836 3:108963986-108964008 CCAGTAATTCACAGGCAATGACA 0: 1
1: 0
2: 0
3: 11
4: 188
Right 959669838 3:108964004-108964026 TGACAGAATGGCCCACCACTTGG 0: 1
1: 0
2: 0
3: 6
4: 123
959669836_959669840 -3 Left 959669836 3:108963986-108964008 CCAGTAATTCACAGGCAATGACA 0: 1
1: 0
2: 0
3: 11
4: 188
Right 959669840 3:108964006-108964028 ACAGAATGGCCCACCACTTGGGG 0: 1
1: 0
2: 4
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959669836 Original CRISPR TGTCATTGCCTGTGAATTAC TGG (reversed) Intronic
900085447 1:892600-892622 TGTTATAGCCTGTGAATATCAGG + Intergenic
906892517 1:49732470-49732492 AGTCTTTGCCTGTTAAATACAGG - Intronic
907806546 1:57826281-57826303 CATCATTGCATGTGAACTACTGG - Intronic
909021702 1:70438544-70438566 TTTTTTTGCCTGTGAATTATAGG + Intronic
909537709 1:76756933-76756955 AGTCATTCCCTCTGAATTTCAGG + Intergenic
910012892 1:82487149-82487171 TGTCCTTCCCTCTGAATCACAGG + Intergenic
910277250 1:85462954-85462976 TGTCCTGTCCTGTGAATTTCAGG + Intronic
913226818 1:116707874-116707896 TTTTATTTCCTGTGAATTACTGG - Intergenic
915126045 1:153665726-153665748 TGTCATTTTCTGTCAATTAGTGG - Exonic
916149774 1:161775661-161775683 TGTCATTTGCTGAGAATTTCTGG + Intronic
916900953 1:169222706-169222728 TGTCATTGTCTGTGAAGTCAAGG - Intronic
917630737 1:176889011-176889033 TATTATTGCCTTTGAATAACAGG + Intronic
921633952 1:217469581-217469603 TTTCATTTCCTTTCAATTACAGG - Intronic
922563522 1:226586499-226586521 TGTCTTAGCCTGTGGATTAGTGG + Intronic
1063966109 10:11347164-11347186 TGTCATTGCCTGAGTTTTTCAGG + Intergenic
1068255427 10:54503396-54503418 AGTCATTGCTTGTGAAATAAGGG + Intronic
1069560647 10:69426949-69426971 TGTCATAATCTGTGTATTACAGG - Intergenic
1079540456 11:21566851-21566873 TCACTTTGCCTTTGAATTACAGG - Intronic
1081008364 11:37775846-37775868 TATCCTTGCCTTTGTATTACAGG + Intergenic
1081267659 11:41046276-41046298 TGTCCTTGTCTGTAAAATACAGG - Intronic
1083383151 11:62284873-62284895 TTTGATAGCCTGTGAATTTCAGG + Intergenic
1086420253 11:86631408-86631430 TGTCACTGCCTATAAGTTACAGG - Intronic
1086837890 11:91648285-91648307 TGTAATTGCATGTGGATTAAGGG - Intergenic
1087625508 11:100591348-100591370 TGTCTTTGCATGTGACATACTGG + Intergenic
1093122033 12:15282431-15282453 TTTCTTTGTCTGTGAATTATTGG - Intronic
1093600920 12:21021350-21021372 TGACACTGTCTTTGAATTACCGG - Intronic
1093709414 12:22312893-22312915 TTTCATTTCTTGTGAATTACTGG + Intronic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1097389962 12:58998090-58998112 TGTCATTGCCTGATAATTCTGGG - Intergenic
1099021431 12:77409482-77409504 TGGAATTACCTGTGAATTATGGG + Intergenic
1099154488 12:79157675-79157697 TGTCACTGCCAGTGAAAGACTGG + Intronic
1104369642 12:128212467-128212489 TGACCATGCCTGAGAATTACAGG + Intergenic
1104822204 12:131683707-131683729 TGTCTTTGTCTGTGGATTTCTGG + Intergenic
1106143122 13:27027509-27027531 TGTCATTGTCTTTGAATTCAGGG - Intergenic
1106634460 13:31512280-31512302 TGTCATTGGCTGGGATTTATTGG - Intergenic
1107675931 13:42796852-42796874 TGTGAGTGCCTGTGAAATGCAGG - Intergenic
1110571321 13:77008077-77008099 TGGCACTGTCTGTGCATTACTGG - Intronic
1111268656 13:85852634-85852656 GGTGATTGTCTTTGAATTACAGG - Intergenic
1113546959 13:111160346-111160368 TGTGATTCCATGTGAATTTCAGG + Intronic
1113626732 13:111853305-111853327 TGGAATTGCCTGTGAATTGCTGG - Intergenic
1114199968 14:20510936-20510958 TGTCATTGCCTGTGAGCTCAAGG + Exonic
1114923787 14:27367114-27367136 TGTCATTGCCTCTGAAGACCTGG + Intergenic
1117839026 14:59838363-59838385 AGTTATTTCCTGTGAATTCCTGG - Intronic
1118384666 14:65245651-65245673 TCTTATTGCCTGTGAAGTAGAGG - Intergenic
1118478341 14:66140047-66140069 TGTCAGTTCCTGTGAACTCCAGG - Intergenic
1119442064 14:74635176-74635198 TTTCCTTGCCTTTGAATTAGTGG - Intergenic
1122661281 14:103297233-103297255 TGTGATTGCCTGTGCATTTGTGG - Intergenic
1122671749 14:103378161-103378183 TATCATTGCCTGTGCTTTGCAGG - Intergenic
1202843152 14_GL000009v2_random:142624-142646 TGTTATAGCCTGTGAATATCAGG + Intergenic
1202912552 14_GL000194v1_random:132875-132897 TGTTATAGCCTGTGAATATCAGG + Intergenic
1202880082 14_KI270722v1_random:49766-49788 TGTTATAGCCTGTGAATATCAGG - Intergenic
1123736283 15:23187399-23187421 GGGCATTTCCTGTGAATTGCAGG - Intergenic
1124286990 15:28410372-28410394 GGGCATTTCCTGTGAATTGCAGG - Intergenic
1124295711 15:28501255-28501277 GGGCATTTCCTGTGAATTGCAGG + Intergenic
1125572270 15:40729668-40729690 TTTCAGTGGCTGTGAATTCCAGG + Intronic
1126318064 15:47392061-47392083 TCTCATTGCCTGTTTATTAAAGG + Intronic
1128304639 15:66589997-66590019 TGTCATTTTATGTAAATTACTGG + Intronic
1130217871 15:81989260-81989282 TGTCCCTGGCTCTGAATTACTGG - Intergenic
1133316963 16:4890900-4890922 GGCCATGGCCTGTGAGTTACAGG - Exonic
1141355650 16:83344173-83344195 TGGCATTTCCAGTGAATCACGGG - Intronic
1145772408 17:27502945-27502967 TGGCATTGCCTGTCAGTAACTGG - Intronic
1149163362 17:53721311-53721333 TTTCATAGCCTGTGAATATCAGG + Intergenic
1149299863 17:55295336-55295358 GATCATTTCCTGTGAATTACTGG - Intronic
1149445531 17:56710446-56710468 TGGCATTGCCTGTAAATTCCCGG - Intergenic
1149724142 17:58875679-58875701 TGTGATTGTCTGTGAATCACAGG - Intronic
1152479570 17:80541359-80541381 TGTCCTTGCTTGTGAAGAACTGG + Intergenic
1152725370 17:81942348-81942370 TGTCATTGCCTGGGGTTCACAGG + Exonic
1155601058 18:27548235-27548257 AGACTTTGCCTGAGAATTACAGG + Intergenic
1157891343 18:51421060-51421082 TCTCATTGCTTTTGAAGTACTGG + Intergenic
1159012759 18:63073673-63073695 TGGCTTGGCCTGTGAATGACAGG + Intergenic
1165066764 19:33234203-33234225 TGTCACAGCCTGAAAATTACAGG - Intergenic
1165283526 19:34817809-34817831 TGTGAATGTGTGTGAATTACTGG - Intergenic
1202655698 1_KI270708v1_random:18858-18880 TGTTATAGCCTGTGAATATCAGG - Intergenic
925847845 2:8049824-8049846 TGTCATTGCCTTTGGATGAATGG - Intergenic
925890441 2:8429941-8429963 TTAAATTGCATGTGAATTACAGG + Intergenic
927234857 2:20862814-20862836 TTTTATTGCCTCTGAATTTCAGG - Intergenic
929990763 2:46784267-46784289 TCTCATTGTCTGTGATTTAGTGG - Intergenic
930369752 2:50487892-50487914 TGGCATTTCCTGTGAATTCCTGG + Intronic
930372638 2:50523325-50523347 AGTCATTGCCTGTCAGTGACTGG - Intronic
930852026 2:55971789-55971811 TTTCAGAGCCTGTGAAATACTGG + Intergenic
936369357 2:111890655-111890677 TGTCATTTCCTGGGAATGGCTGG - Intergenic
938085306 2:128396047-128396069 TATTACTGCCTGTGAATAACTGG + Intergenic
938213076 2:129484927-129484949 TGTCATTACCTCTGTATTGCAGG - Intergenic
938979239 2:136509989-136510011 TGTCAATATCTGTAAATTACGGG - Intergenic
939257854 2:139767722-139767744 TGTCATTTTCTGTGAAATTCAGG + Intergenic
940063728 2:149602119-149602141 TATCATTACCTGGGAATTACTGG - Intergenic
940572225 2:155452338-155452360 TGTCATTGCTAGTGAAAGACAGG - Intergenic
942695039 2:178632652-178632674 TGTCATCACCTGTGATTTCCTGG + Exonic
945746813 2:213728394-213728416 AGTTCTTGCCTGTGAGTTACTGG - Intronic
1168825055 20:805392-805414 TTTGATAGCCTGTGAATTTCAGG - Intergenic
1169072391 20:2740849-2740871 TGTCATTGGCTGTGGGCTACTGG + Intronic
1169560871 20:6799496-6799518 TATCATTGCCTCTGCAATACTGG - Intergenic
1175660068 20:60804705-60804727 TGTCATTGCCTGGGGAATCCAGG - Intergenic
1176631908 21:9147548-9147570 TGTTATAGCCTGTGAATATCAGG + Intergenic
1176641394 21:9307305-9307327 TGTTATAGCCTGTGAATATCAGG - Intergenic
1180350415 22:11796659-11796681 TGTTATAGCCTGTGAATATCAGG - Intergenic
1180374693 22:12080072-12080094 TGTTATAGCCTGTGAATATCAGG - Intergenic
1180387798 22:12195406-12195428 TGTTATAGCCTGTGAATATCAGG + Intergenic
949543866 3:5055385-5055407 TCTCTTTGTCTGTGAATTTCTGG + Intergenic
952789303 3:37186614-37186636 TGTTATTGACTGTGACATACTGG - Intergenic
953375978 3:42428890-42428912 TGTTATTGCCTGGGATTTAATGG + Intergenic
954991833 3:54847981-54848003 TATCATTGCCTGTCATTTAAAGG + Intronic
955479914 3:59379160-59379182 TGTAATTGCTTTAGAATTACTGG + Intergenic
955487087 3:59446004-59446026 CCTCAATGCCTGTGAATCACTGG + Intergenic
957098756 3:75803250-75803272 TGTTATAGCCTGTGAATATCAGG + Intergenic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
959880595 3:111440544-111440566 CTTCATTGCCTGTGCATTCCAGG - Intronic
960855085 3:122094489-122094511 TTTCATCGTGTGTGAATTACTGG - Intronic
961983795 3:131110192-131110214 GATCATGTCCTGTGAATTACAGG + Intronic
964116280 3:153139489-153139511 TGTCATTGCTTTTGAATTGGAGG + Intergenic
965123292 3:164591557-164591579 AGTCAATGCTTGTGAATTTCTGG - Intergenic
965764419 3:172115071-172115093 TGTCATTGCCTCTACATCACTGG + Intronic
1202745501 3_GL000221v1_random:97717-97739 TGTTATAGCCTGTGAATATCAGG + Intergenic
969974627 4:11085787-11085809 TGTCATTGATTCTGATTTACAGG - Intergenic
971060357 4:22961544-22961566 TCACATGGCCAGTGAATTACAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975373619 4:73616294-73616316 TGTCTTTGGCTGGGAAATACAGG - Intronic
977702268 4:100034092-100034114 TGTTTTTGCCTGTGAATTGCAGG - Intergenic
978333061 4:107635972-107635994 TGTCACTGACTTTGAAATACTGG - Intronic
978707977 4:111739468-111739490 AGTAAATGCGTGTGAATTACTGG + Intergenic
979128793 4:117012519-117012541 ATTCATTTCCTGTGAATCACTGG - Intergenic
979223748 4:118261215-118261237 TTTCATTCCCAGTTAATTACAGG + Intergenic
980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG + Intergenic
981281947 4:142968657-142968679 TGTCATTTTCTTTGATTTACAGG - Intergenic
983755653 4:171331432-171331454 TGTCAAAACCTGTGAACTACTGG + Intergenic
984420219 4:179511810-179511832 AGCCATTGACTGTGAACTACGGG + Intergenic
984670177 4:182474535-182474557 TCTCATTGCCTGAGAATGTCTGG - Intronic
1202756281 4_GL000008v2_random:65516-65538 TGTTATAGCCTGTGAATATCAGG - Intergenic
986167074 5:5283129-5283151 TGTCATTGCCTTTAAACTAAGGG - Intronic
989540982 5:42618646-42618668 TACGATTGCCTGTGAATTAATGG - Intronic
990760526 5:59124590-59124612 TGTCAATTCATGGGAATTACAGG + Intronic
993184371 5:84598079-84598101 TTGCATTTCCTGTGAATTGCTGG - Intergenic
996201824 5:120685096-120685118 TATCTTTGCCTGTGTCTTACAGG + Intronic
999836599 5:155380113-155380135 TCTCCTTGCCTGTCAATCACTGG + Intergenic
1000410945 5:160934651-160934673 TGTCATTACCTGTGTAACACTGG + Intergenic
1001361761 5:171092960-171092982 TGCCACTGCCTGTGAATTTGTGG + Intronic
1003927565 6:10890717-10890739 TTTCATTGCCTGTGATTTTGAGG + Intronic
1005350383 6:24928639-24928661 TTTCTTTGCCTTTGAATTATTGG - Intronic
1008080825 6:47192950-47192972 TGTCACTGCCAGTGATTTTCTGG - Intergenic
1010144650 6:72653000-72653022 TGTGATTGTCTGTGAATAAATGG - Intronic
1010182393 6:73102703-73102725 TGTTAGTGCCTGTCATTTACTGG - Intronic
1011699894 6:89946205-89946227 TTTCCTTTCCTGTGAATTGCTGG - Intronic
1020505735 7:8985436-8985458 TGGCAGTGCCTGTGATTTATAGG - Intergenic
1020559410 7:9711691-9711713 TGTCTTTGCCTGTGTTTTCCTGG + Intergenic
1021340318 7:19456317-19456339 TGTATTTGCCTGGGGATTACTGG + Intergenic
1021949832 7:25763864-25763886 TGTTATTCCCAGTGTATTACTGG + Intergenic
1024160927 7:46675038-46675060 TGTTATTGCCTCTGAAAAACTGG + Intronic
1024815458 7:53263822-53263844 TGTAGATGCCTGTAAATTACTGG + Intergenic
1027725974 7:81806523-81806545 AGTCATGGCCTGTGAAGTCCAGG - Intergenic
1027824659 7:83095166-83095188 TTTCATATCATGTGAATTACGGG + Intronic
1031238458 7:119208349-119208371 TTTCATTGCCTGTGCATTTGAGG - Intergenic
1031534023 7:122911748-122911770 TGTGATGGCCTGTAAATCACAGG - Intergenic
1038501946 8:28052299-28052321 TGTCACTGCCTGTGTGTTATGGG + Intronic
1038858310 8:31357395-31357417 TGTCATTGCCTATGCTTTAGGGG + Intergenic
1039201862 8:35103997-35104019 TGTCATAGCCTGTAGATAACTGG - Intergenic
1039368708 8:36961888-36961910 TGTCATTTCCTGTAAATTTTAGG + Intergenic
1041134483 8:54742714-54742736 GCTCTGTGCCTGTGAATTACTGG + Intergenic
1041628960 8:60063205-60063227 TGTAATTGCCAGGGAATCACAGG - Intergenic
1042111614 8:65387343-65387365 TGTCACTGCAGGTGAATTAAAGG - Intergenic
1042459322 8:69044694-69044716 TGTCTTTGCCTGTGTATTTCTGG - Intergenic
1042476038 8:69248543-69248565 TGTCATTGACTGTTAGTGACAGG - Intergenic
1043004054 8:74796320-74796342 TTTCTTTTCCTGTGAATCACAGG - Intronic
1045639404 8:104230702-104230724 TTTCCTGGCCTGTGATTTACAGG - Intronic
1046173013 8:110536981-110537003 TGTCATTTACTGTGAATTTTAGG + Intergenic
1046192450 8:110814736-110814758 TGTCATTTCTTTTGAATGACTGG + Intergenic
1048514999 8:135098484-135098506 TTTCATTGCCTGTGCTTTAGGGG + Intergenic
1049848008 8:144813552-144813574 TGTCATTGTATATGAATTTCGGG - Intergenic
1051903812 9:22072102-22072124 TGTCATTGCATTTGGATCACAGG + Intergenic
1057508572 9:95658175-95658197 TGTAATTGCTTGTTAATTGCGGG + Intergenic
1057903079 9:98964586-98964608 CGTCATTGCATGTGAACCACAGG + Intronic
1057909947 9:99011861-99011883 TTTTATAGCCTGTGAATTTCAGG + Intronic
1059484612 9:114617192-114617214 TGCCATGGCCTGTGAACCACAGG + Exonic
1060362314 9:122971163-122971185 TGTTCTTTCCTGTGAAGTACAGG - Intronic
1203687885 Un_GL000214v1:12586-12608 TGTTATAGCCTGTGAATATCAGG - Intergenic
1203754738 Un_GL000218v1:115157-115179 TGTTATAGCCTGTGAATATCAGG + Intergenic
1203714120 Un_KI270742v1:127667-127689 TGTTATAGCCTGTGAATATCAGG + Intergenic
1203537081 Un_KI270743v1:50370-50392 TGTTATAGCCTGTGAATATCAGG - Intergenic
1203648390 Un_KI270751v1:91467-91489 TGTTATAGCCTGTGAATATCAGG + Intergenic
1186188818 X:7049084-7049106 AGTGATTGTCTGTGAATGACAGG - Intronic
1186897993 X:14024190-14024212 TGTCAATGGCTGTGATTTAGAGG + Intronic
1187978643 X:24731006-24731028 TGTAATTGCCGGTGAAATAATGG + Intronic
1188548687 X:31338130-31338152 AGTCATTGGCTGTGGATTTCTGG - Intronic
1188876597 X:35438374-35438396 TTTTATAGCCTGTGAATTTCAGG + Intergenic
1188904579 X:35776927-35776949 TTTAATAGCCTGTGAATTTCAGG + Intergenic
1190321475 X:49182390-49182412 TGGCTTTGCCTGTGAATGAAGGG - Intronic
1192962641 X:76146432-76146454 TTTTATAGCCTGTGAATTTCAGG + Intergenic
1193037137 X:76964051-76964073 TGTGAATGCCTGTGAATCAGTGG + Intergenic
1194666016 X:96678376-96678398 TGGCTTTGCCTGTCAATAACAGG + Intergenic
1195566228 X:106342480-106342502 TTTCATAGCCTATGAATTTCAGG + Intergenic
1195581237 X:106505331-106505353 TTTTATAGCCTGTGAATTTCAGG - Intergenic
1196339009 X:114574094-114574116 TGTCATTGCATCTGAATTTTAGG - Intergenic
1196543886 X:116940009-116940031 TTTTATAGCCTGTGAATTTCAGG + Intergenic
1196884550 X:120230809-120230831 TTTTATAGCCTGTGAATTTCAGG - Intergenic
1198127359 X:133659066-133659088 TGTAATTGCATGTGCATGACAGG - Intronic
1199461997 X:148094854-148094876 TGTCATTGCCTGAAAAGTATTGG + Intergenic
1199678737 X:150209646-150209668 TTTCCTGGCTTGTGAATTACTGG + Intergenic
1199951304 X:152708396-152708418 TGGCCTTGCCCGGGAATTACTGG + Intergenic
1199953950 X:152727619-152727641 TGGCCTTGCCTGGGAATTACTGG + Exonic
1199955738 X:152740831-152740853 TGGCCTTGCCCGGGAATTACTGG - Intergenic
1199958380 X:152760065-152760087 TGGCCTTGCCCGGGAATTACTGG - Intergenic