ID: 959670392

View in Genome Browser
Species Human (GRCh38)
Location 3:108970763-108970785
Sequence GTCTACAAAGGGCTCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959670392_959670396 15 Left 959670392 3:108970763-108970785 CCCTGCGGGAGCCCTTTGTAGAC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 959670396 3:108970801-108970823 AAGCATAGCCAATAGATGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959670392 Original CRISPR GTCTACAAAGGGCTCCCGCA GGG (reversed) Intronic
913653842 1:120943068-120943090 GTTTACAATGGGCTCCCGTAGGG - Intergenic
914644037 1:149637234-149637256 GTTTACAATGGGCTCCCGTAGGG - Intergenic
1063093465 10:2889108-2889130 GTCTACAATGAGCTCCAGCCTGG - Intergenic
1068617796 10:59138726-59138748 TTCTAGAGAGGGATCCCGCAGGG - Intergenic
1070725155 10:78782656-78782678 CTGTCCACAGGGCTCCCGCATGG - Intergenic
1075827495 10:125371593-125371615 GTCTTCAAAGGGCACACCCAGGG - Intergenic
1079324934 11:19483796-19483818 GTCTAGAAATGCATCCCGCAAGG + Intronic
1080120940 11:28676395-28676417 ATCTACCAAGGTCTCCTGCAGGG + Intergenic
1085706193 11:78788583-78788605 GTCAGCAAAGGGCTGCTGCAAGG - Intronic
1091277948 11:134364963-134364985 GTCTGCAGAGGGCTGCAGCATGG - Intronic
1121293308 14:92794853-92794875 GTCTGCAAAGGGCTGCGGCAGGG - Intronic
1122273758 14:100580646-100580668 GGCTATAAGGGGCTGCCGCAGGG - Intronic
1127521272 15:59745393-59745415 GTCAACTATGGGCTCCCTCAAGG + Intergenic
1127699169 15:61480374-61480396 GTCCACAAATGGCTGCCTCAAGG - Intergenic
1128354172 15:66912914-66912936 GACTCCCAAGGGCTCCTGCAAGG - Intergenic
1141815693 16:86408065-86408087 TTCTACAAAGGGCTCCTGCCGGG - Intergenic
1147644138 17:42023784-42023806 GTAGACAAAGGGCTCCAGGAGGG - Exonic
1152548963 17:81019810-81019832 GTCAGCACAGGGCTGCCGCAGGG + Intergenic
1164992169 19:32692343-32692365 CTCCTCAAAGGCCTCCCGCACGG - Exonic
1165166824 19:33862993-33863015 TCCTTCAAAGGGCTCCAGCAAGG - Intergenic
1166068302 19:40373194-40373216 CACTACAAGGGCCTCCCGCAGGG + Intronic
1166167722 19:41004077-41004099 GTCCACAAGGGCCTCCCGTATGG - Exonic
925056597 2:861654-861676 GTCTCCAAATGGCACCAGCATGG + Intergenic
925912075 2:8580693-8580715 GTCACCAAAGGGCTCCCCGAGGG - Intergenic
932167726 2:69523637-69523659 GTCTACAAAGCACTTTCGCATGG - Intronic
940488974 2:154332479-154332501 GTCTATAAAGCCCTCCTGCATGG + Intronic
942685570 2:178527531-178527553 TTCTACAAAGGACTCTTGCATGG + Exonic
948708966 2:239813514-239813536 GTGTTTAAAGGGCTCCCTCAGGG - Intergenic
1169042770 20:2509321-2509343 ATCTACATAGTGCTCACGCAAGG - Intronic
1170626034 20:18030879-18030901 GTCACCAAGGGGCTGCCGCATGG - Intronic
1177108679 21:16995784-16995806 GTCTGCAAAGGGCTCCCCTTGGG + Intergenic
1178234078 21:30821735-30821757 GTCTTCAAAGGACAACCGCACGG - Intergenic
950079817 3:10213348-10213370 GTCTACAGAGGGCACAGGCACGG + Exonic
950360477 3:12446017-12446039 GGCTAGAAAGGGCTCAGGCAAGG - Intergenic
953070525 3:39515207-39515229 GTCCAAAAGGGGCTCCTGCAAGG - Exonic
953969335 3:47334823-47334845 GTCTATAAAGGGGAGCCGCAAGG - Intronic
959670392 3:108970763-108970785 GTCTACAAAGGGCTCCCGCAGGG - Intronic
961863888 3:129939601-129939623 GTCCACAAAAGGCTGCCACAGGG - Intergenic
969363416 4:6679786-6679808 GTCTTCAAAGTGCTACCTCAGGG - Intergenic
969529308 4:7721689-7721711 GTCTGCAAAGGGCACCCGGTGGG + Intronic
969531790 4:7734453-7734475 ATCTAGAAAGGGCCCCAGCAGGG + Intronic
976400296 4:84599141-84599163 GTCTGCAAAGGGCTCCCAGCAGG - Intronic
988295410 5:29353904-29353926 GTCTACAAAGGCCTTGTGCAGGG + Intergenic
996565702 5:124878085-124878107 GTCTACAAAAGGCTCATACAGGG - Intergenic
1004408457 6:15357818-15357840 GTCTGCAGAGGGCTGCTGCAAGG - Intronic
1006005309 6:30997209-30997231 GTGTACAGAGGACTCCAGCAGGG + Intergenic
1006575535 6:35042666-35042688 GTCCACAAAGGGTGCCGGCAGGG + Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1014563370 6:122917833-122917855 GTCTACAAATTGCTCCTGGAAGG - Intergenic
1014752307 6:125269299-125269321 GCCCACAGGGGGCTCCCGCATGG + Intronic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1018631324 6:165825543-165825565 GTCTACAAAAGGCTCCTGCTGGG + Intronic
1018908496 6:168088705-168088727 GTCTACAAAGCCCTCCTGCCTGG - Intergenic
1033534284 7:142298052-142298074 GAATACAAAGGGATTCCGCAGGG - Intergenic
1040699036 8:50038970-50038992 TTCCCCAAAGGGCTCCTGCAGGG - Intronic
1042576565 8:70227110-70227132 GCCCACAAAGGGCTGCCTCATGG - Intronic
1047183966 8:122615255-122615277 GTCTAGAAAGGGCTACTTCATGG - Intergenic
1047974102 8:130112373-130112395 GTGTACAGAGGGCCTCCGCAGGG + Intronic
1050374779 9:4959320-4959342 GTCTTCAAAGGGCTCCAGACTGG + Intergenic
1190167611 X:48085987-48086009 GTATACAGATGGCTCCAGCAAGG + Intergenic
1198762580 X:140048602-140048624 GTGTAAAAAGGGCTTCAGCATGG - Intergenic