ID: 959671765

View in Genome Browser
Species Human (GRCh38)
Location 3:108986396-108986418
Sequence CAGGGGATGTAATGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959671765_959671772 22 Left 959671765 3:108986396-108986418 CCTGAGACACATTACATCCCCTG 0: 1
1: 0
2: 0
3: 6
4: 298
Right 959671772 3:108986441-108986463 TGTTTGTTGAACTACTTTTAGGG 0: 1
1: 0
2: 1
3: 23
4: 257
959671765_959671771 21 Left 959671765 3:108986396-108986418 CCTGAGACACATTACATCCCCTG 0: 1
1: 0
2: 0
3: 6
4: 298
Right 959671771 3:108986440-108986462 GTGTTTGTTGAACTACTTTTAGG 0: 1
1: 0
2: 0
3: 21
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959671765 Original CRISPR CAGGGGATGTAATGTGTCTC AGG (reversed) Intronic
901052866 1:6434285-6434307 GAAGAGATGGAATGTGTCTCAGG - Intronic
902480627 1:16709788-16709810 GAAGAGATGGAATGTGTCTCAGG + Intergenic
902481374 1:16713764-16713786 GAAGAGATGGAATGTGTCTCAGG + Intergenic
904419244 1:30380854-30380876 CAGTGGATGCAATGAGTCTTGGG - Intergenic
905499743 1:38427047-38427069 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
907292593 1:53426236-53426258 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
907482099 1:54752254-54752276 CAGGGCAAGTAATTTGTCTGAGG + Intergenic
907521222 1:55024566-55024588 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
907739022 1:57145611-57145633 AAGGAGAAGTAATTTGTCTCAGG - Intronic
908461751 1:64353712-64353734 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
908591991 1:65645619-65645641 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
909776732 1:79492307-79492329 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
909909924 1:81247405-81247427 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
911510655 1:98805016-98805038 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
911570365 1:99511603-99511625 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
912296438 1:108474917-108474939 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
917454900 1:175177882-175177904 TAGTGAATGTAATGTGTGTCTGG + Intronic
920829364 1:209450902-209450924 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
921212381 1:212911471-212911493 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
922049572 1:221976851-221976873 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
922154108 1:223028151-223028173 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
922906362 1:229176386-229176408 CCAGGGCTGTAAAGTGTCTCAGG - Intergenic
923214234 1:231833982-231834004 CCAGGGCTGTAAAGTGTCTCAGG + Intronic
923257312 1:232232947-232232969 CCAGGGCTGTAAAGTGTCTCAGG + Intergenic
923770778 1:236935999-236936021 CCAGGGCTGTAAAGTGTCTCAGG + Intergenic
923816691 1:237387846-237387868 CAGAGGATTTTATGTGTCTGAGG + Intronic
924896219 1:248339974-248339996 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1063509638 10:6633340-6633362 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1063830018 10:9942020-9942042 CAGGGGCCTTTATGTGTCTCTGG + Intergenic
1067243350 10:44515657-44515679 CAGAGGATGAAATGTCTATCTGG + Intergenic
1067858963 10:49824808-49824830 AAGGTTATGTAATTTGTCTCAGG + Intronic
1068058387 10:52037508-52037530 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1068230936 10:54168721-54168743 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1068592382 10:58864763-58864785 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1073222439 10:101886721-101886743 CAGAGGCTGGAATGTGTCTAGGG + Intronic
1075214379 10:120519445-120519467 GAGGGGATCTAGTGTGTCCCAGG - Intronic
1075940081 10:126383814-126383836 CAAAGGTTGGAATGTGTCTCTGG - Intronic
1078046163 11:7915907-7915929 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1078391939 11:10942611-10942633 CAGTGGATTCACTGTGTCTCAGG + Intergenic
1080027950 11:27632822-27632844 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1080124580 11:28717950-28717972 CAGGGAATGAATTTTGTCTCAGG - Intergenic
1081356770 11:42122542-42122564 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1083743845 11:64724462-64724484 CAGGTGTTCTTATGTGTCTCTGG - Intergenic
1083763404 11:64830822-64830844 CAGGAGATGTTATGAGGCTCTGG + Intronic
1085790117 11:79490187-79490209 CAAGGGGGGTTATGTGTCTCTGG + Intergenic
1086004979 11:82027159-82027181 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1086134877 11:83435359-83435381 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1091886475 12:4020496-4020518 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1092723756 12:11465916-11465938 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1092739362 12:11613441-11613463 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1092789671 12:12060358-12060380 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1093071200 12:14708616-14708638 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1097398547 12:59103805-59103827 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1099188676 12:79541825-79541847 CTGGGGCTGTAAAGCGTCTCAGG - Intergenic
1100758411 12:97777685-97777707 CAGAGGAAATAATTTGTCTCAGG - Intergenic
1101496844 12:105262898-105262920 CAGTGGATTTAATGTTTCTGTGG + Intronic
1103075426 12:117978713-117978735 AAGGGGATGGAATGTGTGTGTGG + Intergenic
1106062262 13:26305348-26305370 CAGGTGATGTACTTTTTCTCCGG + Intronic
1107075539 13:36318408-36318430 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1108894091 13:55301094-55301116 CAGAAGGTGTGATGTGTCTCTGG - Intergenic
1108913457 13:55581991-55582013 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1108919583 13:55658720-55658742 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1109499260 13:63215089-63215111 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1109709704 13:66145083-66145105 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1110356541 13:74574051-74574073 AAGGGAATGTAATGTGTATCAGG + Intergenic
1110501085 13:76229508-76229530 CAGTGGAAGTAATGTGGCCCAGG - Intergenic
1110765439 13:79276100-79276122 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1111630401 13:90841410-90841432 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1111631742 13:90852333-90852355 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1113801341 13:113088025-113088047 CAGGGGAGCTCATGTGTCCCTGG + Intronic
1116179639 14:41517908-41517930 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1116534815 14:46016150-46016172 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1116613474 14:47106147-47106169 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1116952875 14:50895137-50895159 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1120618221 14:86733283-86733305 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1120659996 14:87238783-87238805 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1120726334 14:87945596-87945618 CAGCCCATGTAATGGGTCTCTGG + Exonic
1121980621 14:98450896-98450918 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1123882531 15:24689320-24689342 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1124767905 15:32504129-32504151 AAGCGGAAGTCATGTGTCTCAGG - Intergenic
1125131553 15:36289387-36289409 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1130855077 15:87833234-87833256 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1130945983 15:88551247-88551269 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1131447703 15:92513450-92513472 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1131882554 15:96875578-96875600 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1132262974 15:100442225-100442247 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1133651360 16:7816670-7816692 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1133959616 16:10481909-10481931 CTGGGGAGGAAGTGTGTCTCGGG - Exonic
1138804910 16:60080799-60080821 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1139225952 16:65233578-65233600 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1140193218 16:72835766-72835788 CAGGGTATACAATGAGTCTCAGG - Intronic
1141756864 16:85997070-85997092 TTGGAGATGTGATGTGTCTCTGG + Intergenic
1141865243 16:86745767-86745789 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1146961730 17:36986099-36986121 CAGGAGATCTCATGTGCCTCTGG - Intronic
1147253455 17:39167129-39167151 CAGGGCAGCTAATGGGTCTCAGG - Intronic
1151741555 17:75986208-75986230 CAGGGGAGGTAATAGGTCCCAGG - Exonic
1156118802 18:33818879-33818901 CATAGAATGTAATGTGGCTCTGG + Intergenic
1156302205 18:35845839-35845861 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1156661360 18:39350318-39350340 CATGGGATGTAATGTGCATCTGG + Intergenic
1158394679 18:57070369-57070391 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1161661679 19:5550438-5550460 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1162229759 19:9256328-9256350 CAGGGGGTGTAAATTGTCACAGG + Intergenic
1163907145 19:20157502-20157524 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1164004124 19:21133543-21133565 TAGGGGCTGTAAAGTGTCTAAGG + Intergenic
1164152936 19:22570208-22570230 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1164170011 19:22716776-22716798 AAGGGAATGTAACATGTCTCTGG - Intergenic
1165249201 19:34515935-34515957 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1165835318 19:38751556-38751578 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1167902109 19:52629739-52629761 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1168434729 19:56308008-56308030 CAGGGGATGGAATGTGGGTGGGG - Intronic
1202714667 1_KI270714v1_random:35696-35718 GAAGAGATGGAATGTGTCTCAGG + Intergenic
1202715413 1_KI270714v1_random:39675-39697 GAAGAGATGGAATGTGTCTCAGG + Intergenic
925544515 2:5002947-5002969 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
925699853 2:6625448-6625470 CAGCTGATGTACTGAGTCTCTGG - Intergenic
926413551 2:12628469-12628491 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
926591241 2:14742400-14742422 CAGGGTATGTGATATGTCCCAGG - Intergenic
927133235 2:20078590-20078612 CAGAGGAGGTGATGTGTCTGAGG + Intergenic
929383503 2:41379874-41379896 CTGGGGCTGTAAAGCGTCTCAGG - Intergenic
930480090 2:51937277-51937299 GAGGGAATGTCATGTCTCTCAGG + Intergenic
931625737 2:64254500-64254522 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
932143104 2:69296936-69296958 CCGGAGATGTAATGTGTATGGGG - Intergenic
933013052 2:77090344-77090366 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
933079233 2:77967077-77967099 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
933179807 2:79215588-79215610 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
933613745 2:84462927-84462949 CAGAGGATGGCATGTCTCTCAGG - Intergenic
936883295 2:117280709-117280731 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
940675842 2:156723811-156723833 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
941353346 2:164461082-164461104 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
941439382 2:165514419-165514441 CCGGGGATGTAATGTACCTCAGG - Intronic
941456223 2:165714238-165714260 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
941935932 2:170981403-170981425 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
944387412 2:199181340-199181362 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
944876164 2:203965659-203965681 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
945153140 2:206810599-206810621 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
945301524 2:208220005-208220027 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
945394264 2:209301192-209301214 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
948069426 2:235107606-235107628 CAGGGTCTGAAATTTGTCTCTGG + Intergenic
948390645 2:237608923-237608945 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1170068901 20:12344018-12344040 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1170513455 20:17103579-17103601 GATGGGTTATAATGTGTCTCTGG + Intergenic
1173118834 20:40271025-40271047 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1174045681 20:47730968-47730990 CAGGGGCTGGCATGTGACTCAGG + Intronic
1177031215 21:15983559-15983581 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1177119525 21:17123430-17123452 CTGGGGCTGTAAAGCGTCTCAGG - Intergenic
1180913331 22:19468804-19468826 CAGGGCATCTAATGTGGCTTGGG - Intronic
1181891413 22:26066905-26066927 CTGGGGATTTGATGTGTCCCCGG + Intergenic
1184074734 22:42169150-42169172 CAGGGGCTGCACTGTGTCTCTGG - Intronic
949162136 3:894411-894433 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
949827402 3:8178984-8179006 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
953072061 3:39530626-39530648 CTGGGGACATAAGGTGTCTCTGG + Intergenic
953077172 3:39581542-39581564 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
953177157 3:40562959-40562981 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
954161802 3:48728110-48728132 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
954872175 3:53775950-53775972 CCGGGGTTGTAATCTGACTCAGG - Exonic
955000598 3:54923860-54923882 CAGGGGCTGTATTGTCTATCTGG - Intronic
955877522 3:63508445-63508467 CAGGTGATGTAAGGTGACTCTGG + Intronic
956549030 3:70438632-70438654 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
957295202 3:78325847-78325869 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
957317351 3:78586889-78586911 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
958750967 3:98192935-98192957 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
959671765 3:108986396-108986418 CAGGGGATGTAATGTGTCTCAGG - Intronic
960282917 3:115797247-115797269 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
960534979 3:118805589-118805611 CAGGTGATGTAATGGGGCTTGGG - Intergenic
963456700 3:145554918-145554940 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
965070289 3:163909510-163909532 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
966398483 3:179524677-179524699 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
967496183 3:190146472-190146494 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
967561347 3:190922072-190922094 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
968628330 4:1637881-1637903 CAGGGGCTGCACTGTGCCTCAGG + Intronic
968993346 4:3929344-3929366 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
970244596 4:14046650-14046672 CAGGGAATGTAGTGTCTGTCTGG - Intergenic
972603165 4:40590530-40590552 CAGGTGAGGCAATGTGTCTAAGG - Intronic
974252795 4:59409864-59409886 CAGGAAATATAAAGTGTCTCAGG + Intergenic
974428437 4:61768035-61768057 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
975437961 4:74375657-74375679 TAGTGGATGTAATATTTCTCTGG + Intronic
975865128 4:78717605-78717627 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
976006645 4:80438334-80438356 CAGGGGGCCTAATGTGTCTGAGG + Intronic
976884611 4:89968539-89968561 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
977010276 4:91626055-91626077 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
977624820 4:99179076-99179098 CAGGGGAGGTGAAGTGGCTCTGG - Intergenic
977782479 4:100995553-100995575 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
979351420 4:119648393-119648415 TAGGAGATGTAATGGCTCTCTGG - Intergenic
980284906 4:130769297-130769319 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
980388885 4:132120164-132120186 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
981040204 4:140215458-140215480 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
981502730 4:145469853-145469875 CAGGGGTTTGAATGTGTGTCAGG - Intergenic
981539683 4:145834709-145834731 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
982084007 4:151816348-151816370 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
982180516 4:152745098-152745120 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
982497147 4:156107213-156107235 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
982535405 4:156602246-156602268 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
983360369 4:166718264-166718286 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
983414750 4:167439551-167439573 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
983452297 4:167924858-167924880 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
983659536 4:170118419-170118441 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
985389910 4:189483210-189483232 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
985582318 5:704754-704776 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
986919627 5:12666286-12666308 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
987300772 5:16596358-16596380 CAGGGAAAGAAATGTGCCTCTGG - Intronic
987449573 5:18065033-18065055 AAGGTGATGGAATTTGTCTCTGG - Intergenic
987972088 5:24959801-24959823 GAGGGGATAAAAGGTGTCTCTGG + Intergenic
988323048 5:29725303-29725325 CTGCAGATGTAATGTTTCTCTGG - Intergenic
989467369 5:41772897-41772919 CAGTGCATGGAATGAGTCTCAGG + Intronic
991635481 5:68700101-68700123 CTGGGGATGGAATGTGACTTTGG - Intergenic
995503057 5:112829528-112829550 AAGGGGATTTAATGTATATCAGG + Intronic
995899407 5:117050112-117050134 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
996203299 5:120701337-120701359 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
996344864 5:122477351-122477373 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
996509866 5:124305734-124305756 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
996745487 5:126843305-126843327 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
997746359 5:136303250-136303272 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
998045694 5:138984884-138984906 CAGGGGATGAGATGCTTCTCAGG + Intronic
1000519450 5:162279123-162279145 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1001331493 5:170765780-170765802 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1001594762 5:172891069-172891091 CTGGGGATTAAATGTGTCCCGGG + Intronic
1002326503 5:178412883-178412905 CAGATGATGTACAGTGTCTCAGG - Intronic
1002611005 5:180418472-180418494 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1004575185 6:16887921-16887943 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1004768615 6:18757811-18757833 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1004836957 6:19540841-19540863 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1005014699 6:21365254-21365276 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1010586738 6:77664302-77664324 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1010826953 6:80486184-80486206 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1010841354 6:80651576-80651598 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1012014431 6:93833824-93833846 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1012066585 6:94557693-94557715 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1013161598 6:107550281-107550303 CAGAGGATGGAACTTGTCTCAGG + Intronic
1013249779 6:108322518-108322540 CAGGAGATGTAATATGTGTCTGG + Intronic
1014454911 6:121624186-121624208 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1014555808 6:122841796-122841818 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1014614715 6:123586035-123586057 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1014718854 6:124894000-124894022 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1014794031 6:125705608-125705630 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1015165184 6:130194307-130194329 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1015266693 6:131297419-131297441 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1015323790 6:131903649-131903671 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1017019795 6:150130905-150130927 CAGGGGAGGAAATGTGGCACTGG + Intergenic
1017412125 6:154179016-154179038 CAGGGGATGCACTGTGCCCCAGG + Intronic
1017838941 6:158205707-158205729 CAGGGCCTGGAATGTGTCACTGG - Intergenic
1018084539 6:160290318-160290340 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1018521513 6:164655898-164655920 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1018716851 6:166539712-166539734 CAAGGGAAGTCATGTGACTCTGG - Intronic
1021393581 7:20122534-20122556 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1021429805 7:20547412-20547434 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1021637274 7:22705207-22705229 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1021810622 7:24398240-24398262 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1022372832 7:29786810-29786832 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1022555289 7:31288293-31288315 CATGGCCTGTAATCTGTCTCTGG + Intergenic
1025724593 7:64045312-64045334 CAGGAGATGTAATGAGACACTGG - Intronic
1027386701 7:77666083-77666105 AAGGGGATAAAATGGGTCTCTGG + Intergenic
1027821628 7:83053175-83053197 AAGGAGATGGGATGTGTCTCAGG - Intronic
1027851903 7:83461631-83461653 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1028670471 7:93395895-93395917 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1028690138 7:93641824-93641846 CTAGGGCTGTAAAGTGTCTCAGG - Intronic
1029790487 7:102838169-102838191 CATGAGATGTTTTGTGTCTCTGG + Intronic
1031296575 7:120010828-120010850 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1031727972 7:125262649-125262671 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1031776284 7:125911952-125911974 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1033815294 7:145063620-145063642 CATGGTATGTAAAGAGTCTCAGG + Intergenic
1033909506 7:146247126-146247148 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1034702669 7:153109870-153109892 CAGGGTTTTTAATGTGTTTCAGG - Intergenic
1036236263 8:7042145-7042167 CAGGGGAGGTCCTGTGTATCCGG - Intergenic
1036281441 8:7404401-7404423 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1036340028 8:7907171-7907193 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1038035706 8:23684337-23684359 GATGGTATGTCATGTGTCTCTGG + Intergenic
1039155730 8:34554457-34554479 CAGGAGATGAACTTTGTCTCAGG + Intergenic
1041424988 8:57710690-57710712 CTGAGGATATAATGTTTCTCAGG + Intergenic
1042707328 8:71676875-71676897 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1043451122 8:80367773-80367795 CAAGGGATGTCATTTGTCTGGGG - Intergenic
1046386384 8:113513260-113513282 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1046512043 8:115214189-115214211 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1048585462 8:135770894-135770916 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1048728466 8:137412049-137412071 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1049280503 8:141741729-141741751 CAGGGGCTGTCACCTGTCTCTGG + Intergenic
1050896029 9:10886699-10886721 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1051052584 9:12950284-12950306 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1051989907 9:23140105-23140127 CAGAGGCTGTAATTGGTCTCAGG + Intergenic
1052720682 9:32168291-32168313 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1055233019 9:74087627-74087649 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1055810006 9:80139373-80139395 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1056323843 9:85460610-85460632 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1056522405 9:87412890-87412912 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1057234804 9:93349569-93349591 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1059439606 9:114299600-114299622 CAGGGGATATGGTGTGTCCCTGG + Intronic
1059574580 9:115475323-115475345 CTAGGGATGTAAAGCGTCTCGGG - Intergenic
1187086565 X:16048433-16048455 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1189656083 X:43246470-43246492 CAAGGGTTTTAATTTGTCTCAGG + Intergenic
1193885893 X:86983770-86983792 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1193941456 X:87683854-87683876 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1194186289 X:90777065-90777087 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1194293666 X:92103981-92104003 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1194503021 X:94702564-94702586 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1194822810 X:98528019-98528041 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG + Intergenic
1196073043 X:111545882-111545904 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1196165505 X:112532581-112532603 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1196330783 X:114468728-114468750 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1197064874 X:122224000-122224022 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1199576441 X:149317633-149317655 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1200532879 Y:4359142-4359164 CTAGGGCTGTAAAGTGTCTCAGG + Intergenic
1200611183 Y:5328527-5328549 CTAGGGCTGTAAAGTGTCTCAGG + Intronic
1200659575 Y:5943146-5943168 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic
1201125261 Y:10907314-10907336 CAGGTGATGTAACTTTTCTCTGG + Intergenic
1201581351 Y:15514340-15514362 CTAGGGCTGTAAAGTGTCTCAGG - Intergenic