ID: 959674827

View in Genome Browser
Species Human (GRCh38)
Location 3:109022695-109022717
Sequence TGGATTGGTTGACTCTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959674827_959674830 5 Left 959674827 3:109022695-109022717 CCTATGTAGAGTCAACCAATCCA 0: 1
1: 0
2: 1
3: 3
4: 94
Right 959674830 3:109022723-109022745 ATATAAAATATTCACCTTTCAGG 0: 1
1: 0
2: 2
3: 40
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959674827 Original CRISPR TGGATTGGTTGACTCTACAT AGG (reversed) Intronic
903513737 1:23895853-23895875 TGGAATGCATGACTCTGCATAGG + Intronic
906416752 1:45625893-45625915 TTGACTGGTTGACTTTACAATGG + Intergenic
913161315 1:116148450-116148472 TGGGTCGTTTGACTCTAGATGGG - Intergenic
917498321 1:175563024-175563046 TTGCTTGGCTGACTCTGCATGGG - Intronic
919964313 1:202506180-202506202 TCTAGTGGTTGACTCCACATTGG + Intronic
923345675 1:233050005-233050027 TGGATTGGAAGAATCAACATAGG + Intronic
924377549 1:243429418-243429440 TGGATTTTTTGACTGTACAGGGG + Intronic
1064745487 10:18474488-18474510 TGGATTGTTAGACTGTACAAAGG + Intronic
1065406690 10:25374042-25374064 TGGATTGGTTCACTCTTTTTAGG + Intronic
1066486329 10:35848651-35848673 TGGTATGGTTGACCCTACAAAGG + Intergenic
1066655185 10:37692158-37692180 TGGATTGGAAGTCTCAACATGGG + Intergenic
1067040244 10:42948300-42948322 TGGATTGGAAGTCTCAACATAGG + Intergenic
1067307298 10:45076205-45076227 TGGTATGGTTGACCCTACAAAGG + Intergenic
1067814914 10:49466636-49466658 TGGATTGGTTGTCTGGGCATGGG - Intronic
1071329491 10:84545735-84545757 TGGAATTGTTGGCTTTACATAGG + Intergenic
1073596771 10:104808428-104808450 AGGAATGGCTGACTCTAAATGGG + Intronic
1082115003 11:48318444-48318466 TGGAGTCTTTGACTCAACATTGG + Intergenic
1088391383 11:109318766-109318788 TGGATTGGATCACTGTACCTAGG - Intergenic
1097568561 12:61301797-61301819 TAGTTTGGTTGACTTCACATTGG + Intergenic
1099812755 12:87605667-87605689 TGGATTGGTTGACTAGAAACTGG - Intergenic
1100026940 12:90141291-90141313 TGGATTGCTTCAGTCTACAGTGG + Intergenic
1104176589 12:126338895-126338917 TGGAATGGGTGACTCTACTTAGG - Intergenic
1110049479 13:70876493-70876515 TAGAATGGTTGACTATGCATTGG + Intergenic
1118113464 14:62748949-62748971 CGGCTTGGTTGACCCTATATCGG - Intronic
1120537441 14:85714273-85714295 TGGTTTGGTTGATTGTACAAAGG + Intergenic
1122144320 14:99680208-99680230 TGAATTGGCTGCCTTTACATGGG - Exonic
1123829273 15:24117313-24117335 TGGATTGGCTGAGTCTGGATTGG + Intergenic
1123859281 15:24447040-24447062 TGGATTGGCTGAATCTGGATTGG + Intergenic
1124355272 15:28990698-28990720 TGAATTGGGAGACTCTTCATGGG - Intronic
1124690476 15:31817610-31817632 AGCATGGATTGACTCTACATGGG + Intronic
1126196997 15:45943335-45943357 TGCTTTGGTTCACTCTACAATGG + Intergenic
1126869001 15:52967597-52967619 TGGAATGGTAGAGTCTTCATTGG + Intergenic
1140610923 16:76598100-76598122 TGTTTTGGTTGACTGTACTTTGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144182903 17:12769636-12769658 TGGCCTTGTTGATTCTACATAGG - Intergenic
1144196248 17:12897893-12897915 TGGATTGGTGGAGTTTTCATTGG + Intronic
1153713807 18:7825362-7825384 TGGATAGGTTGATTTTGCATAGG + Intronic
1159316627 18:66783161-66783183 TGGATTTCTTGGGTCTACATGGG + Intergenic
1161881575 19:6958120-6958142 TGGATTGATTGACTCCTTATAGG - Intergenic
1164368518 19:27617113-27617135 TGGTTTTGTTGAATCTACAAAGG + Intergenic
1168029316 19:53666972-53666994 TGGATTGGTTGCCTCTTCTCTGG - Intergenic
1168029653 19:53669456-53669478 TGGATTGGTTGCCTCTTCTCTGG - Intergenic
932658979 2:73635771-73635793 TGGATTGGTTTTCTATACTTTGG - Intergenic
932970575 2:76536043-76536065 TGGATTAGTTTACTGTTCATTGG + Intergenic
935898384 2:107763021-107763043 TGGGTTGATTGACTTTACAAAGG - Intergenic
936836137 2:116711386-116711408 TGTATTGTTTTACTCTACTTTGG - Intergenic
939031977 2:137087685-137087707 TGGATGGGTAGAATCTATATCGG + Intronic
941563589 2:167079790-167079812 TGGTTTTGTTGATTCTTCATAGG + Intronic
945767741 2:214000610-214000632 TGGAGTGTTTAACTCTACACAGG + Intronic
946573360 2:221048588-221048610 TGGGTTGTTTGACTGTATATTGG + Intergenic
950814572 3:15686900-15686922 AGGGTTGGTTGATTCTACAACGG - Intronic
952054024 3:29422235-29422257 TTGATTGGTATACTCTTCATAGG - Intronic
959674827 3:109022695-109022717 TGGATTGGTTGACTCTACATAGG - Intronic
959854891 3:111140967-111140989 TGGATTCTTTCACTCTACTTTGG + Intronic
962381873 3:134904575-134904597 CGGATGGTTTGACTCTGCATGGG + Intronic
962566624 3:136666986-136667008 TGGTTTGGTTGAAACTATATAGG - Intronic
962724063 3:138204735-138204757 TGGATTTCTTCACTCTACACTGG + Intronic
965338817 3:167461049-167461071 AGGATTGGTTCACTCTAACTAGG + Intronic
967528624 3:190523198-190523220 TGGATTGCTTGAATTTGCATGGG + Intronic
969956527 4:10896828-10896850 AATATTGGTTGTCTCTACATTGG + Intergenic
970009537 4:11444034-11444056 GGATTTGGTTGACTCCACATGGG - Intergenic
971634020 4:29033468-29033490 TGGATTGGATAAATCTACCTTGG + Intergenic
971941287 4:33218979-33219001 TGTATTGGTTGATTTTACAGAGG - Intergenic
972932883 4:44096113-44096135 TGGCTTTGTTGAGTCTCCATAGG + Intergenic
973920444 4:55679304-55679326 TGGATGGGTAGACTCAATATTGG + Intergenic
977306559 4:95330535-95330557 TGAATTGGCTGTCTGTACATAGG + Intronic
978670378 4:111241425-111241447 TGTATTGGTGGACTATACTTAGG + Intergenic
984005393 4:174299939-174299961 TGGATTGGTTAAATGTTCATTGG + Intronic
986074099 5:4316610-4316632 TTGATTGGATGACTCTATTTGGG + Intergenic
993438610 5:87926877-87926899 TGGATTGTTTTACTCTTCCTTGG - Intergenic
1002015076 5:176314771-176314793 AGGATTTTTTGACTTTACATTGG + Intronic
1003777589 6:9386091-9386113 TGGATTAGAAGACTCAACATAGG - Intergenic
1003935018 6:10966999-10967021 TGAATTGGTTATTTCTACATTGG - Intronic
1004339798 6:14798335-14798357 TGGATGTGCTGACTCTACAGGGG - Intergenic
1008521039 6:52362447-52362469 TGGATTCGGAGACTCAACATCGG - Intronic
1010549997 6:77210178-77210200 TGGATTGGAAGAATCAACATTGG - Intergenic
1012155202 6:95811024-95811046 TGGATTGGAAGACTCCACATAGG - Intergenic
1015563800 6:134544684-134544706 TGATTTTGATGACTCTACATTGG - Intergenic
1023239271 7:38126374-38126396 CAGACTGGTTGACTCTACAAGGG - Intergenic
1023945841 7:44802557-44802579 TGGCTTTTTAGACTCTACATAGG - Exonic
1027808020 7:82854253-82854275 TGGATTGGTTAACTCTGCATGGG + Intronic
1027876726 7:83779667-83779689 TGTATTTGTTGACTCGTCATAGG + Intergenic
1031132755 7:117851691-117851713 TGGTTTGGTGGACTGTAGATAGG - Intronic
1031246942 7:119325588-119325610 TGGATGGGAAGGCTCTACATTGG + Intergenic
1033686620 7:143646582-143646604 GGGATTGGCTGACACTACACAGG - Intronic
1033689114 7:143720725-143720747 GGGATTGGCTGACACTACACAGG + Intronic
1033697989 7:143811032-143811054 GGGATTGGCTGACACTACACAGG + Intergenic
1037434526 8:18848495-18848517 TGGCTTGGCTGCCTCTCCATGGG - Intronic
1041160214 8:55033828-55033850 TAGATTGGTACATTCTACATTGG + Intergenic
1041710580 8:60890748-60890770 TGGGGTGGTTGTCTCTACAGAGG - Intergenic
1048284614 8:133132167-133132189 TGCATTTGATGACTCTAGATCGG + Intronic
1049499946 8:142956820-142956842 TGGATTGGAAGACTCAACATAGG + Intergenic
1055582011 9:77715768-77715790 TGAATAGGTAGACTCCACATGGG - Intergenic
1055857260 9:80704377-80704399 TGGTTTGTTTAATTCTACATTGG - Intergenic
1056425154 9:86468250-86468272 GTGATTAGTTGACTGTACATGGG + Intergenic
1056537846 9:87546488-87546510 TGAATTGGTTGGGTCTGCATAGG + Intronic
1194667563 X:96692573-96692595 TGGAAAGGTTGACTATACAAGGG + Intronic
1197472516 X:126881119-126881141 TGGATTGCTTGACTCCCCAATGG - Intergenic
1197555228 X:127944924-127944946 CAGACTGGTTGACTCAACATAGG - Intergenic