ID: 959676825

View in Genome Browser
Species Human (GRCh38)
Location 3:109045185-109045207
Sequence GATGCAGAACCACCTGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959676825 Original CRISPR GATGCAGAACCACCTGAAAG TGG (reversed) Intronic
900034678 1:397083-397105 TATGAAGAACTACCTGAAACCGG - Intergenic
900055509 1:626965-626987 TATGAAGAACTACCTGAAACCGG - Intergenic
900729086 1:4240301-4240323 GAAGCAGACCCACCTCAATGTGG + Intergenic
900858171 1:5203002-5203024 GAAGCAGACATACCTGAAAGCGG + Intergenic
902153894 1:14467789-14467811 GAGGCTGAAACACCTGAGAGTGG - Intergenic
902605300 1:17565813-17565835 GATGCAGTCCCACCTTAAAGAGG + Intronic
904594259 1:31633104-31633126 GGGGCAGAGCCACCTGATAGTGG - Intronic
906778744 1:48553257-48553279 GATGCAGTTCAACCTGAGAGGGG + Intronic
907023042 1:51087195-51087217 GATGGTGAACCACCAGACAGTGG + Intergenic
910321134 1:85945680-85945702 AATCCAGAACCACCTGAAATTGG - Intronic
910506319 1:87953708-87953730 GATGCAGAGACAACTGAGAGGGG - Intergenic
913465500 1:119138207-119138229 GATGCAGAAATATGTGAAAGAGG - Intronic
915499425 1:156304717-156304739 GAGGCAGAATCACTTGAAACTGG + Intergenic
916707934 1:167372289-167372311 GATGAAGCAACACCTGAAACAGG - Intronic
918229297 1:182513690-182513712 TTTGGAGAACCTCCTGAAAGTGG - Intronic
918491737 1:185088683-185088705 GATGCAGAACCCCATGTATGTGG - Intronic
918613829 1:186522228-186522250 GAGACTGCACCACCTGAAAGAGG - Intergenic
920686427 1:208112553-208112575 GATGCAGACCCCACTGAAGGTGG + Intronic
922257202 1:223902641-223902663 TATGAAGAACTACCTGAAACCGG - Intergenic
924338401 1:243005449-243005471 TATGAAGAACTACCTGAAACCGG - Intergenic
1063917969 10:10903784-10903806 GATGCAGAGCCACCTGCACAGGG + Intergenic
1067960597 10:50844058-50844080 GATGCTGCACCCCCTGAAAGGGG - Exonic
1068424495 10:56841354-56841376 GATGCAGAAACAACAGAAAGTGG + Intergenic
1070014131 10:72507971-72507993 GGTATAGAACCACCTGAGAGAGG - Intronic
1071380100 10:85050558-85050580 GGTGCTGAAACACCTGAAGGTGG - Intergenic
1072181930 10:92991824-92991846 GAAGGAGAACAACCTGAGAGGGG + Intronic
1073729300 10:106270750-106270772 TTTACAGAACCTCCTGAAAGTGG + Intergenic
1074095492 10:110308257-110308279 GATGGAAAACAACCTGAAAATGG + Intergenic
1075435920 10:122441632-122441654 GATAAAGAACCCACTGAAAGAGG + Exonic
1076689024 10:132211471-132211493 GCTCCAGAACCATCTGGAAGGGG + Intronic
1078622872 11:12925188-12925210 TATGAAGAACTACCTGAAAATGG + Intronic
1079292175 11:19198247-19198269 GATACAGAACCAGCTTAACGGGG - Intronic
1079846453 11:25476402-25476424 TATGCAGAAGCACCTGAGACTGG - Intergenic
1087474162 11:98616957-98616979 TATAAAGAACCACCTGAAACTGG + Intergenic
1088288423 11:108210595-108210617 TATGAAGAAACACCTGAGAGTGG - Intronic
1089114231 11:116081222-116081244 AGTGCAGAACCACCTGGGAGGGG - Intergenic
1089548488 11:119250313-119250335 GGGAAAGAACCACCTGAAAGGGG - Intronic
1091399277 12:172652-172674 GATGGAGAAGCACCTGCCAGAGG - Intronic
1091564093 12:1635153-1635175 GATGAAGACCCGACTGAAAGAGG + Intronic
1095978522 12:47956535-47956557 TATGAAGAACTACCTGAAACTGG - Intergenic
1097024564 12:56045171-56045193 GAGGCAGAACTGCTTGAAAGGGG - Intergenic
1097404652 12:59175710-59175732 GAATGAGAACCAACTGAAAGGGG + Intergenic
1097632931 12:62086115-62086137 TATGAAGAACCACCTGAGACTGG - Intronic
1097858193 12:64490053-64490075 GATGAAGATCAACCTGGAAGCGG + Exonic
1099071769 12:78053117-78053139 GCAGGAGAACCACCTGAAACCGG + Intronic
1100179808 12:92073105-92073127 GAATCAGAACCAAGTGAAAGGGG + Intronic
1100325045 12:93532524-93532546 GAATCAGAACCAAGTGAAAGGGG + Intergenic
1101171611 12:102102756-102102778 TATGCAGAATCAACTGAAATTGG - Intronic
1101357131 12:103990871-103990893 TATGCAGAACTACCTCAGAGGGG + Intronic
1103243784 12:119437640-119437662 GATGCAGAAGCGACTGAGAGCGG - Intronic
1106110359 13:26771589-26771611 GAGGCAGGACCCACTGAAAGTGG - Intergenic
1107120984 13:36795627-36795649 GAGTCAGAAGCACCTGAGAGAGG - Intergenic
1110489635 13:76087937-76087959 TATAAAGAACCACCTGAAACTGG + Intergenic
1114152166 14:20054559-20054581 GAGGCAGAACCACCCCCAAGAGG - Intergenic
1115178731 14:30596924-30596946 GATACAGAAGCACCAGACAGAGG - Intronic
1115547094 14:34473913-34473935 GAGGCAGAATCGCCTGAAACTGG - Intergenic
1117605409 14:57423567-57423589 GATGCAGAGGCAGCAGAAAGTGG + Intergenic
1118044148 14:61948444-61948466 GATGGAGGACAACCTGAAACTGG + Intergenic
1118084990 14:62404362-62404384 TATGAAGAAACACCTGAAACTGG - Intergenic
1120104510 14:80479332-80479354 GATGAAGACACACCTGAAACTGG + Intronic
1121708537 14:96019678-96019700 GATCCACAACCACCAGAAAGTGG + Intergenic
1123001805 14:105299920-105299942 TATTCACAACCACCTGAAACTGG + Intronic
1123464852 15:20507350-20507372 GGTGGAGAACCACCTGAACCCGG - Intergenic
1123653265 15:22493679-22493701 GGTGGAGAACCACCTGAACCCGG + Intergenic
1123743685 15:23302542-23302564 GGTGGAGAACCACCTGAACCCGG + Intergenic
1124275576 15:28323329-28323351 GGTGGAGAACCACCTGAACCCGG - Intergenic
1124307125 15:28588272-28588294 GGTGGAGAACCACCTGAACCCGG + Intergenic
1124444852 15:29721526-29721548 GATAAAGAACCACCTGAGACTGG - Intronic
1125773767 15:42192068-42192090 GATGTAGCATCACCTGAAAGCGG - Intronic
1127313643 15:57774483-57774505 GAGGCAGAATCACCGGAATGTGG - Intronic
1131240797 15:90740934-90740956 TATGAAGAAACACCTGAGAGTGG - Intronic
1134417098 16:14053635-14053657 GCAGCAGAATCACTTGAAAGCGG + Intergenic
1135675085 16:24408307-24408329 TATGAAGAACTACCTGAGAGTGG + Intergenic
1135693082 16:24560603-24560625 GATGCAGAACCATGTGTATGAGG - Intronic
1137464111 16:48692426-48692448 GAATCAGAACCACCTGAATGAGG - Intergenic
1139297277 16:65912610-65912632 GGTGCAGAATCACCAGCAAGTGG + Intergenic
1140550486 16:75860717-75860739 GATACAGAACCAAATGAAAAAGG - Intergenic
1141638802 16:85329479-85329501 GCTGCAGAGCCACCTGCAGGTGG + Intergenic
1144279927 17:13715952-13715974 GATGAAGAAGCATCTTAAAGGGG + Intergenic
1146529153 17:33593263-33593285 GATTCAAAACCACTGGAAAGAGG - Intronic
1147914108 17:43876560-43876582 GATGGGGAACCCCCAGAAAGGGG + Intronic
1148196314 17:45715930-45715952 GAAGCAGAGCCTCCAGAAAGTGG - Intergenic
1149371108 17:55994125-55994147 GAATGAGAACCAACTGAAAGGGG + Intergenic
1153787092 18:8544764-8544786 GACACAGAACCAGCTTAAAGGGG + Intergenic
1156986705 18:43358216-43358238 TATGCTGAACCAACTTAAAGAGG - Intergenic
1157140190 18:45098044-45098066 GCTGCAAAATCAACTGAAAGTGG - Intergenic
1158976958 18:62717519-62717541 GAAGCAGATCCCTCTGAAAGCGG + Intronic
1160149240 18:76386636-76386658 GCATCAGAACCACCAGAAAGAGG + Intronic
1160459999 18:79031889-79031911 TATGAAGAACCACCTGAAACTGG + Intergenic
1167216513 19:48169545-48169567 GATGGAGAATCATCTGAATGGGG - Intronic
929533747 2:42767815-42767837 GTTGCAGAACCCCCTGCCAGAGG - Intronic
932806747 2:74791107-74791129 TATGGAGGACCACCTGAAACAGG - Intergenic
933015884 2:77126731-77126753 GATTTAGAAACACCTGGAAGTGG + Intronic
939069124 2:137518262-137518284 GATCCTGCACCACCCGAAAGTGG + Intronic
939748063 2:146003169-146003191 GATACAGAACCACCAGAAGCTGG - Intergenic
940317671 2:152341977-152341999 GTTGCAGACTCACCTCAAAGAGG - Intronic
941391162 2:164916646-164916668 CAGGCAGAACCATCTGACAGTGG + Intronic
943269674 2:185783000-185783022 GATGCGGATACACTTGAAAGTGG - Intronic
945950589 2:216035288-216035310 GATGCAAAACCCCCTGAGGGAGG - Intronic
946282510 2:218676425-218676447 TATACAGAACCACCTGAGACTGG + Intronic
947719603 2:232362499-232362521 TATGAAGAAACACCTGAAACTGG - Intergenic
948136133 2:235637719-235637741 GAAGCAGAACCATATGGAAGAGG + Intronic
1168997530 20:2144367-2144389 GGTGAAGAACCGCCTGGAAGAGG + Exonic
1172224979 20:33299450-33299472 GACCCAGAACCACCTGCATGGGG + Intronic
1172749168 20:37237739-37237761 AATGCAGAACCACCAGGAAAAGG - Intronic
1173646481 20:44636276-44636298 CATGCAGTTCCACCTGCAAGGGG + Exonic
1174079710 20:47962321-47962343 ATTCCAGAACCACCTGAGAGAGG + Intergenic
1177354160 21:19985239-19985261 GATACAGAAACACCTGCTAGTGG + Intergenic
1177965537 21:27722181-27722203 GAAACAGAAACACCTGAAACTGG - Intergenic
1178122472 21:29482936-29482958 GATGAAGGGCCACCTGAGAGAGG - Intronic
1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG + Intronic
1180262058 21:46678161-46678183 GATGAAGAACCACCTGAGCCTGG - Intergenic
1182945483 22:34317430-34317452 TATGAAGAACTACCTGAAACAGG - Intergenic
1184900936 22:47446023-47446045 GATGCACAAACACCTGCCAGTGG - Intergenic
949597824 3:5566269-5566291 GGTGCAGAGACACCTGGAAGGGG - Intergenic
953563983 3:44015378-44015400 GACTCAGAAACACCTGAAAGAGG - Intergenic
954757452 3:52849163-52849185 GATACTGATCCACCTGGAAGAGG + Intronic
955511309 3:59683212-59683234 GGTGAAGAAGCACCTGAGAGAGG - Intergenic
957627337 3:82670710-82670732 AATGCAGAACCAAGTAAAAGAGG + Intergenic
959497380 3:107067342-107067364 TATACAGAACCACCTGAGACTGG + Intergenic
959676825 3:109045185-109045207 GATGCAGAACCACCTGAAAGTGG - Intronic
960494693 3:118360377-118360399 GCTGCAGCACCACCTGAAAGTGG - Intergenic
961168451 3:124779557-124779579 TATGAAGAACCACCTGGAAAAGG + Intronic
964144101 3:153437837-153437859 CATGCAAAACCACCAGAAACAGG - Intergenic
964388020 3:156169875-156169897 TATGAAGAACTACCTGAAATTGG - Intronic
965346161 3:167553392-167553414 GATGTAGAGTCACCTAAAAGTGG - Intronic
967540857 3:190666196-190666218 GATTCTGCACTACCTGAAAGGGG - Intergenic
970274525 4:14383891-14383913 GAAGGAGAACCACCATAAAGTGG - Intergenic
974565875 4:63577859-63577881 TTTGGAGAACCTCCTGAAAGTGG - Intergenic
975968043 4:79999476-79999498 TATGAAGAACTACCTGAAACTGG - Intronic
979238719 4:118429819-118429841 TATGAAGAACTACCTGAAACCGG + Intergenic
980513553 4:133824360-133824382 GAATCAGAACCAAGTGAAAGGGG - Intergenic
982098839 4:151948149-151948171 TATGAAGAAACACCTGAAACTGG - Intergenic
985424335 4:189813482-189813504 GATACCAAGCCACCTGAAAGAGG + Intergenic
985673914 5:1220564-1220586 CATGCATAACCACCTAAATGTGG + Intronic
986531028 5:8737064-8737086 CATGCATAACCCCCTTAAAGGGG + Intergenic
986596966 5:9432609-9432631 GATTCATAACCACCTGACCGTGG - Intronic
990450281 5:55926976-55926998 GAAGGAGAACCAAGTGAAAGGGG + Intergenic
990628391 5:57640409-57640431 GAGGCAGAAAGACCTTAAAGTGG + Intergenic
992167477 5:74068939-74068961 GATGCAGAACCAAATGCAGGAGG - Intergenic
993219287 5:85069978-85070000 GATGCAGATACCACTGAAAGTGG + Intergenic
995729927 5:115227676-115227698 GATGGAGAAGAACCTAAAAGGGG - Intronic
995775234 5:115717855-115717877 CAACCAGAACCACCTGGAAGTGG - Intergenic
998118364 5:139556312-139556334 GAGGCAGAATCACCTGAACCCGG + Intronic
998228213 5:140342979-140343001 TGGGCAGAACCACCAGAAAGAGG + Intronic
998513615 5:142733987-142734009 GGTGCAGAACCACCTCATGGAGG + Intergenic
1000295543 5:159910373-159910395 GCTGCAGAAACAGATGAAAGTGG + Intergenic
1001349512 5:170945360-170945382 GATACAGAACCACGTTAAAAAGG + Intronic
1002739141 5:181421788-181421810 TATGAAGAACTACCTGAAACCGG + Intergenic
1004479527 6:16005525-16005547 GAAACAAAACCAACTGAAAGTGG + Intergenic
1005543148 6:26834865-26834887 TATGAAGAACTACCTGAGAGTGG - Intergenic
1006303644 6:33207027-33207049 GCTGCAGAACCAGTGGAAAGGGG - Intergenic
1007977334 6:46114829-46114851 GCTACAGAAGCAGCTGAAAGAGG + Intergenic
1008104470 6:47427518-47427540 TATGAAGAAACACCTGAAACTGG + Intergenic
1008118677 6:47584850-47584872 TATGTAGAACCACATGTAAGAGG + Intronic
1012964178 6:105655749-105655771 CAGGCACCACCACCTGAAAGTGG + Intergenic
1013311608 6:108900095-108900117 TATGAAGAGCCACCTGAGAGAGG - Intronic
1013499911 6:110738938-110738960 GAGGCAGGATCAGCTGAAAGGGG - Intronic
1014244462 6:119052737-119052759 GAAGCAGCACTAGCTGAAAGAGG + Intronic
1014374888 6:120660155-120660177 TATACAGAACTACCTGAAACTGG + Intergenic
1014696618 6:124629282-124629304 GGTGCAGAAGTACCTGAAAGTGG - Intronic
1017651162 6:156583753-156583775 GACGGAGAAACACCTGTAAGCGG + Intergenic
1018706541 6:166467695-166467717 GATGGAGAAGCACACGAAAGTGG - Intronic
1018892335 6:167990785-167990807 GAGGCAGAACGTCCTGGAAGAGG - Intergenic
1019244251 6:170697340-170697362 TATGAAGAACTACCTGAAACCGG + Intergenic
1020558992 7:9705612-9705634 GATGCAGAACCCACAGACAGAGG + Intergenic
1023104323 7:36748525-36748547 GCTGCATAACCTCCTGAGAGAGG + Intergenic
1023275563 7:38515571-38515593 TATGAAGAACTACCTGAAACTGG - Intronic
1023475632 7:40574908-40574930 GATACAGAAACAGCAGAAAGAGG + Intronic
1023876191 7:44287462-44287484 GTGGCAGAACCACCAGGAAGGGG - Intronic
1024366712 7:48528764-48528786 GAGTCATGACCACCTGAAAGAGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1026824100 7:73570596-73570618 GATGCAGGGCCACCTGAAGCGGG - Exonic
1027125557 7:75554369-75554391 GGTTCAGAAGCACCTGAATGCGG - Intronic
1030459886 7:109821191-109821213 GATGCAGAAGGATCAGAAAGAGG - Intergenic
1034241824 7:149616811-149616833 GATGCAGCACCAGGTGGAAGTGG + Intergenic
1035503874 8:110820-110842 TATGAAGAACTACCTGAAACCGG - Intergenic
1047407301 8:124596202-124596224 GAAGCAGAACCAAATCAAAGTGG - Intronic
1049981199 9:905251-905273 GATGCACAGCCTCCTGGAAGGGG + Intronic
1053573656 9:39335975-39335997 GAGGAAGAACAAACTGAAAGAGG - Intergenic
1053838279 9:42164534-42164556 GAAGAAGAACAAACTGAAAGAGG - Intergenic
1054095226 9:60894660-60894682 GAAGAAGAACAAACTGAAAGAGG - Intergenic
1054116690 9:61170585-61170607 GAAGAAGAACAAACTGAAAGAGG - Intergenic
1054123488 9:61283034-61283056 GAGGAAGAACAAACTGAAAGAGG + Intergenic
1054591065 9:67011976-67011998 GAAGAAGAACAAACTGAAAGAGG + Intergenic
1055269633 9:74543332-74543354 GATGCAGCTCCTCCTCAAAGGGG - Intronic
1056509954 9:87295091-87295113 GCTGGAGAATCACCTGAAACCGG + Intergenic
1060529947 9:124342201-124342223 GATGCAAACCCACCTGTAAGTGG + Intronic
1060558469 9:124522734-124522756 AATGCAGCACCACCTTAAAGAGG + Exonic
1203604439 Un_KI270748v1:46564-46586 TATGAAGAACTACCTGAAACCGG + Intergenic
1186747551 X:12585012-12585034 GAAGCAGAACCACTTGAACTCGG - Intronic
1192133379 X:68574056-68574078 GTTTCAGAAGCACATGAAAGTGG - Intergenic
1195910829 X:109887083-109887105 CACCCAGAACCACCTGAATGAGG - Intergenic
1197504678 X:127287053-127287075 TATGCAGTACCACCTGAAGGTGG - Intergenic
1199382757 X:147190046-147190068 GAGGCAGAATCACCTGAACCCGG - Intergenic
1199476622 X:148253720-148253742 GATGAAGAAATACCTGAAATTGG - Intergenic
1201159229 Y:11155653-11155675 GCTGCAGCACCACCTGCAAAAGG - Intergenic
1202386494 Y:24331610-24331632 TATGAAGAACTACCTGAAACCGG + Intergenic
1202484292 Y:25338518-25338540 TATGAAGAACTACCTGAAACCGG - Intergenic