ID: 959676994

View in Genome Browser
Species Human (GRCh38)
Location 3:109047168-109047190
Sequence ATGTACAATATGAGGACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 8, 2: 11, 3: 58, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959676994 Original CRISPR ATGTACAATATGAGGACTGT AGG (reversed) Intronic
905099603 1:35507550-35507572 AGGGACAATGTGAGAACTGTGGG + Intronic
907860317 1:58346321-58346343 AAATACAATATGAGGACCCTAGG - Intronic
908966780 1:69774458-69774480 ATGTACAGCATGAGGACTATAGG + Intronic
909163262 1:72181973-72181995 ATGTACAATATGCGGACCAGAGG + Intronic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
910590495 1:88924497-88924519 ATTTTAAATATGAGGTCTGTGGG - Intergenic
910896758 1:92078004-92078026 ATGTACAGCATGAGAACTATAGG - Intergenic
911047924 1:93643711-93643733 ATGGACAACATGAGGACTATAGG + Intronic
911969366 1:104410922-104410944 CTTTACAATATGAGAACTGGTGG + Intergenic
913461802 1:119094749-119094771 AAATACAACATGAGGACTATAGG - Intronic
913940895 1:125103729-125103751 ATGTGCACTGTGAGGTCTGTGGG + Intergenic
913943813 1:125138177-125138199 ATGTGCACTGTGAGGTCTGTGGG - Intergenic
916509494 1:165459331-165459353 GTGTGCAACATGAGGACTGTAGG + Intergenic
916820208 1:168390870-168390892 CTATACAACATGAGGACTATAGG + Intergenic
917896269 1:179490975-179490997 ATGTGCAATTTGAGAATTGTAGG + Intronic
917909592 1:179629632-179629654 ATGCAAAATATGAAGACTGAAGG + Intronic
918622330 1:186619839-186619861 ATATATGACATGAGGACTGTAGG - Intergenic
918967253 1:191367345-191367367 ATGTACAATATAAGGATTATAGG + Intergenic
919377556 1:196813894-196813916 AAGTACAAGGTGAGGACTGATGG + Intergenic
921268135 1:213443033-213443055 ATGCAGAATTTGAGAACTGTTGG + Intergenic
921529812 1:216267845-216267867 ATGTAAAATATGTATACTGTGGG - Intronic
922823076 1:228497624-228497646 ATGTACAACAGGAGGAATGTAGG + Intergenic
1064181949 10:13125318-13125340 ATGTACAATATAAGAATTTTAGG - Intronic
1064798869 10:19045982-19046004 ATGTACAGCATGAGTACTATAGG - Intergenic
1065639167 10:27764126-27764148 ATGTACAAGATGAGGATTATAGG + Intergenic
1067915100 10:50388922-50388944 ATGTACAATATGAGGATGATAGG + Intronic
1068163540 10:53299094-53299116 ATGTACAGCATGAGGACTATAGG - Intergenic
1068443753 10:57094757-57094779 TTTTGCAACATGAGGACTGTAGG - Intergenic
1068690896 10:59912680-59912702 ATGTTCAATATCTTGACTGTGGG + Intergenic
1071362237 10:84860298-84860320 ATGTACTGCATGAGGACTATGGG - Intergenic
1074910391 10:117903200-117903222 ATCAACATTATGAGGACTGGTGG - Intergenic
1075964695 10:126601270-126601292 ATGTACAACATGAGGACTCTAGG + Intronic
1079280254 11:19080852-19080874 CTGTACAAAACAAGGACTGTAGG + Intergenic
1081653158 11:44839161-44839183 ATGTACAGTCTGAAAACTGTAGG - Intronic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1082926856 11:58557627-58557649 ATGTACAACATAAGAACTATCGG + Intronic
1083131400 11:60626498-60626520 ATGTACAGCATGAGGACTATAGG + Intergenic
1085228551 11:74944935-74944957 ATGTTAAATATGATGGCTGTTGG + Intronic
1086276809 11:85139695-85139717 ATGTACACCATGAGGACTGTAGG - Intronic
1087867637 11:103251600-103251622 ATGTACAACATGAGGACTGTAGG - Intronic
1088275070 11:108076350-108076372 ATGTACAGCATGAGAACTATAGG - Intronic
1092064717 12:5580262-5580284 ATGTACAATATGTACAATGTTGG + Intronic
1092321445 12:7480606-7480628 ATGTACAACATGAGGATTATAGG + Intronic
1093398102 12:18708076-18708098 ATGTATCATATGAGGATTATAGG - Intronic
1093725190 12:22499177-22499199 ATGTAGAATTTTAGAACTGTAGG + Intronic
1094029066 12:25989981-25990003 ATGTGCAAAATGGAGACTGTAGG + Intronic
1095047052 12:37518491-37518513 ATATACAACATGAGGACTATAGG + Intergenic
1098101844 12:67026308-67026330 ATGTAGAATATGAGAACTATGGG - Intergenic
1098795545 12:74884011-74884033 ATGTACAACATGAGGACTATTGG + Intergenic
1098883190 12:75937322-75937344 ATGTAAAATATGAGGAGCTTTGG + Intergenic
1099793855 12:87371122-87371144 ATGTACAACATGAGGATTAAAGG - Intergenic
1100048824 12:90418675-90418697 ATGTACGACATGAGGACTATAGG + Intergenic
1106966369 13:35074876-35074898 ATGTACAACATGAGGACTGTAGG - Intronic
1107565042 13:41593684-41593706 TTGTACAATGTGAAGACTGAAGG - Intronic
1109076247 13:57839675-57839697 ATGTACAGTGTGAGAACTATAGG - Intergenic
1111814241 13:93130718-93130740 ATGTTCAATATGAGTAGTGAAGG + Intergenic
1112601568 13:100860637-100860659 ATGTACAACACGAGTACTGTAGG - Intergenic
1115076485 14:29398507-29398529 ATGTAGAATATGAGTAGTGGTGG - Intergenic
1115111123 14:29823928-29823950 ATGTTCAATTTGAGAACTCTGGG + Intronic
1115303013 14:31905185-31905207 ATGTACCCTATGAGGACTAGAGG - Intergenic
1116290188 14:43024510-43024532 ATGTACGATGTGAGGACTATGGG + Intergenic
1119142553 14:72280893-72280915 TTATAGTATATGAGGACTGTGGG - Intronic
1119724916 14:76916323-76916345 CTGTACAATAAGAGGCCTGTGGG - Intergenic
1120009985 14:79402981-79403003 ACCTATAATTTGAGGACTGTGGG + Intronic
1120075516 14:80153184-80153206 ATGTACAATATGAATATTGTTGG + Intergenic
1121735341 14:96214167-96214189 ATGGAAAACATGAGGACTGGCGG - Intronic
1121903704 14:97720015-97720037 ATGTACAACATAAGGACTACAGG - Intergenic
1122506968 14:102237878-102237900 CTGTAGATTATGAGGACTGTAGG - Intronic
1123395284 15:19928788-19928810 ATGTGCACTGTGAGGTCTGTGGG - Intergenic
1123683383 15:22779938-22779960 ATGTATGACATGAGGACTGCAGG - Intronic
1124804243 15:32865221-32865243 GTGTACAATCTGATGACTTTTGG - Intronic
1125647758 15:41286891-41286913 ATGTACAACATGACAACTATAGG - Intergenic
1126475086 15:49057172-49057194 ATGTGCAGTATCATGACTGTAGG - Intergenic
1126986555 15:54317642-54317664 ATGTACAATATGATGCCTTGAGG + Intronic
1129573851 15:76719473-76719495 ATGTACAACAGGAGGGCTATAGG + Intronic
1133847634 16:9470487-9470509 ATGTACAACATGAAGACTATAGG - Intergenic
1136697611 16:32099692-32099714 ATGTGCACTGTGAGGTCTGTGGG - Intergenic
1136769962 16:32827924-32827946 ATGTGCACTGTGAGGTCTGTGGG + Intergenic
1136798110 16:33042974-33042996 ATGTGCACTGTGAGGTCTGTGGG - Intergenic
1139173635 16:64662047-64662069 ATGAACAATATTAGAACTATAGG + Intergenic
1203072384 16_KI270728v1_random:1090028-1090050 ATGTGCACTGTGAGGTCTGTGGG + Intergenic
1142842086 17:2640708-2640730 AAGTACAATATGAGCATTTTGGG - Intronic
1144531833 17:16046627-16046649 ATGGACAAAATGAAGACTGATGG + Intronic
1145691917 17:26751205-26751227 ATGTGCACTGTGAGGTCTGTGGG - Intergenic
1146118772 17:30170382-30170404 ATGTACCACATGAGGACAATAGG - Intronic
1147239959 17:39084252-39084274 CTGTATAACATGAGGACTGTAGG + Intronic
1149646332 17:58244274-58244296 ATGTACAGGCTGAGGACTTTAGG - Intronic
1150567229 17:66352341-66352363 ATGTACTATCTGAGGCCTGGAGG + Intronic
1152972626 18:178500-178522 ATGTACAGTTTGATGACTTTGGG + Intronic
1152973943 18:195004-195026 ATGGACAATACTAGGACAGTTGG - Intronic
1153571810 18:6480954-6480976 ATGTGTAACATGAGGACTATAGG + Intergenic
1155591412 18:27431645-27431667 ATGTACAACATGAGAAATATAGG + Intergenic
1155837330 18:30602429-30602451 ATGTACAACATGAAGACTAGAGG - Intergenic
1156740025 18:40314212-40314234 AAGCAAAATATGAGGACTGCAGG - Intergenic
1157874419 18:51259181-51259203 CTGTACAAGATGGAGACTGTTGG - Intergenic
1157999712 18:52603180-52603202 ATTTACAATAAGATGACTATAGG + Intronic
1158007424 18:52688559-52688581 ATGCACAACATGAGGACTATAGG + Intronic
1158089251 18:53691479-53691501 ATGTCAAATAAGAGGACTGACGG - Intergenic
1159306220 18:66646505-66646527 GTGTACAACATGAGGACTATAGG - Intergenic
1161181206 19:2883847-2883869 TTGTACAATGAGAGGAATGTAGG - Intergenic
1164731629 19:30509743-30509765 ATGTGCAACATGAGAACTGTAGG - Intronic
1202681900 1_KI270712v1_random:14061-14083 ATGTGCACTGTGAGGTCTGTGGG - Intergenic
926821545 2:16856418-16856440 AAGAACAATATGAGAATTGTGGG - Intergenic
927308779 2:21604537-21604559 ATGCACAGTATTAGGAATGTTGG + Intergenic
931986908 2:67751050-67751072 ATGTGCAAAATGAGGACAGCTGG - Intergenic
932687393 2:73883622-73883644 ATGTACACCCTGAGGACTATAGG + Intergenic
933181970 2:79237199-79237221 ATGTACAAGATGATTAATGTTGG - Intronic
933378903 2:81517708-81517730 AGGTACAACATGAGGGCTATAGG + Intergenic
933943479 2:87264708-87264730 ATCTACCATGGGAGGACTGTGGG + Intergenic
934249870 2:90341032-90341054 ATGTGCACTGTGAGGTCTGTGGG + Intergenic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935334947 2:102007422-102007444 AAGTGAAATATGAGGACTCTTGG + Intronic
936336739 2:111596853-111596875 ATCTACCATGGGAGGACTGTGGG - Intergenic
938658144 2:133456895-133456917 ATGAACATTATCAGGACTGTCGG + Intronic
938955679 2:136295858-136295880 ATGTACAACATGAGTATTGTAGG - Intergenic
939503302 2:143012766-143012788 ATGTACAGCATGAGGACTATGGG - Intronic
939932521 2:148253321-148253343 ATGTACAATAGGAAAACTGCTGG + Intronic
940062786 2:149591045-149591067 ATGTACAACATGAGAATTCTGGG - Intergenic
940952393 2:159690188-159690210 ATGTTCAATATAAGAAATGTTGG - Intergenic
941435565 2:165466882-165466904 ATGTACAACATGAGGACTACAGG - Intergenic
943512794 2:188846962-188846984 ATGTACAACATGAGGACTACAGG + Intergenic
943687149 2:190830451-190830473 ATGTATAGCATGAGGACTATAGG - Intergenic
944321868 2:198355220-198355242 ATGTTAAATATGTGGACTCTGGG - Intronic
944359545 2:198836889-198836911 ATGTACACCATGAAGACTATAGG + Intergenic
945030236 2:205656456-205656478 ATGTAAAATATGAAATCTGTTGG + Intergenic
945159929 2:206879184-206879206 ATGTACAACGTGAGGACTATAGG - Intergenic
948081657 2:235210754-235210776 ATGAACAAGATGAAGACTTTTGG - Intergenic
1168783430 20:514871-514893 ATGGACAAAATCAGGAATGTAGG - Intronic
1168961452 20:1872789-1872811 ATGTCCAATATGTGAACTCTGGG - Intergenic
1171541621 20:25962137-25962159 ATATACAACATGAGGACTATAGG + Intergenic
1171799444 20:29598212-29598234 ATATACAACATGAGGACTATAGG - Intergenic
1171844606 20:30258276-30258298 ATATACAACATGAGGACTATAGG + Intergenic
1173443813 20:43099934-43099956 AGGTACCATGTGAGGTCTGTGGG - Intronic
1176636598 21:9249572-9249594 ATGTACAACATGAGGACTGTAGG - Intergenic
1177702107 21:24652892-24652914 ATGTACAATATGCCATCTGTAGG + Intergenic
1178114838 21:29406313-29406335 ATGTCAAATATGGGGACTATAGG + Intronic
1181929833 22:26391884-26391906 ATGTTCAATGGGAGCACTGTGGG - Intergenic
1183743938 22:39682688-39682710 ATGCCCAAGATGAGGGCTGTGGG - Intronic
949147492 3:720181-720203 ATGTCCAATATGTGCACTATAGG - Intergenic
953900360 3:46837409-46837431 ATGAAAGATATAAGGACTGTGGG - Intergenic
954670311 3:52287661-52287683 ATTTAAAAAATGAGGACTGAAGG + Intronic
957104165 3:75865692-75865714 ATGCACAACATGAGGACTGTAGG + Intergenic
957463115 3:80548253-80548275 TTCTAGAAAATGAGGACTGTGGG - Intergenic
958035589 3:88166785-88166807 ATGTACACAGTGAAGACTGTAGG + Intronic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
961200155 3:125039010-125039032 ATCTCCAATATGAGGAGGGTTGG - Intronic
966319394 3:178684420-178684442 ATGTAAAACATGAGCACTATAGG + Intronic
968420682 4:482114-482136 ATGTGCAATATGCGACCTGTGGG - Intronic
970061287 4:12037357-12037379 ATGTTCTATATAAGCACTGTTGG - Intergenic
970390842 4:15611600-15611622 ATGTTCAATAAGACCACTGTAGG + Intronic
970632788 4:17970245-17970267 ATTTACAAAATGAGTAGTGTTGG - Intronic
971103102 4:23491193-23491215 ATGTACAACATGAGGGCTACAGG + Intergenic
971619961 4:28843784-28843806 ATGTACAACACGAGGACTGAAGG - Intergenic
972555321 4:40175480-40175502 ATGCAAAACATGAGAACTGTAGG + Intergenic
973024042 4:45244298-45244320 ATGTACAACATGAGATCTCTAGG - Intergenic
973961845 4:56118236-56118258 ATATACAAAATGAGGAGAGTGGG - Intergenic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
974264543 4:59567522-59567544 ATGTACAACATGAGGACTACAGG + Intergenic
974899999 4:67985043-67985065 ATGGACAATCTCAGGACTGTAGG - Intergenic
974909665 4:68101901-68101923 ATGTACAACATGAGGACTATAGG - Intronic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976873933 4:89831530-89831552 ATCTAATGTATGAGGACTGTAGG + Intronic
977512219 4:97975235-97975257 ATGTACAATTTGATGAATTTTGG - Intronic
978001721 4:103562702-103562724 TTGTACAACATGAGTACTGATGG + Intergenic
978460298 4:108944007-108944029 ATCTCTAATATGAGGAATGTGGG - Intronic
978935408 4:114368761-114368783 ACATACAATATGAAGACTATAGG - Intergenic
979430910 4:120629248-120629270 ATGTAAAACATGAGGACTATAGG + Intergenic
981703773 4:147637510-147637532 TTGTACAACATGAGGATTTTAGG + Intronic
981873907 4:149518188-149518210 AAGTACAATATCAAGAATGTAGG + Intergenic
982466299 4:155737328-155737350 ATGTATAATATGAGTTTTGTTGG - Intergenic
984216710 4:176922278-176922300 AGGTACAACATGAGGACTATAGG - Intergenic
984745366 4:183210368-183210390 ATGTACAACATGAGGACTATAGG + Intronic
1202751486 4_GL000008v2_random:8011-8033 ATGTACAACATGAGGACTGTAGG - Intergenic
989181745 5:38584782-38584804 ATGTAAAAAATGGGGACTATAGG + Intronic
989369152 5:40687426-40687448 ATGTAAAATATAGGGCCTGTTGG + Intronic
990229715 5:53699565-53699587 ATGTACAACATGAGAACTACAGG + Intergenic
990782322 5:59379050-59379072 ATGTTCAATATCAGCACTGCAGG + Intronic
991212719 5:64124635-64124657 ATGTACTAAATGAGTACTGAAGG - Intergenic
991244168 5:64491185-64491207 TTGAAGAATATGATGACTGTAGG - Intergenic
992821492 5:80501507-80501529 ATGTGCAACATGAGGACTCCAGG + Intronic
992958796 5:81938419-81938441 ATGTAAAATATGAGGAGTAAGGG + Intergenic
993210325 5:84941349-84941371 ATGTACAACATGAGGAATATAGG - Intergenic
994381115 5:99072754-99072776 AGGTACAACATGAGGACTATAGG - Intergenic
996321844 5:122226405-122226427 ATGTACAGCAAGAGGACTATAGG + Intergenic
997065272 5:130552425-130552447 ATGTACAACATGAAGACTATAGG + Intergenic
998830589 5:146154112-146154134 TTGTACAATATGGTGACTATAGG + Intronic
1000680731 5:164180950-164180972 ACGTACAATATGGGGACTATAGG + Intergenic
1001148647 5:169206937-169206959 CTGGATAATATGAGAACTGTAGG + Intronic
1003745037 6:8991236-8991258 ATGTACAACTTCAGGACTGTAGG + Intergenic
1005528010 6:26671346-26671368 ATATGAAAAATGAGGACTGTGGG + Intergenic
1005530699 6:26702408-26702430 ATATGAAAAATGAGGACTGTGGG + Intergenic
1005532137 6:26718675-26718697 ACGTAGGAAATGAGGACTGTGGG + Intergenic
1005538658 6:26782990-26783012 ACGTAGGAAATGAGGACTGTGGG - Intergenic
1005540097 6:26799238-26799260 ATATGAAAAATGAGGACTGTGGG - Intergenic
1005542785 6:26830293-26830315 ATATGAAAAATGAGGACTGTGGG - Intergenic
1005595802 6:27378188-27378210 ATGTTCTATATGATGACTGGGGG - Intronic
1005733302 6:28720205-28720227 TTGTACAACATGATGACTATAGG - Intergenic
1007211889 6:40199131-40199153 ATGTACAACATGATGTTTGTAGG - Intergenic
1008871725 6:56280082-56280104 ATGTACAACTTGTGGATTGTAGG - Intronic
1009010914 6:57841344-57841366 ATATGAAAAATGAGGACTGTGGG - Intergenic
1009707405 6:67270269-67270291 ATGTGTAATACGAGGACTATAGG - Intergenic
1010006842 6:71004693-71004715 ATATACCACATGAGGACTATAGG - Intergenic
1010165354 6:72908283-72908305 ATGTACAACATGAGAACTAAAGG + Intronic
1011730397 6:90256800-90256822 ATGTGCAGTATGAAGACTATAGG - Intronic
1011890792 6:92156918-92156940 ATGCACAGCATAAGGACTGTAGG + Intergenic
1012502063 6:99899189-99899211 ATGTACAACATGAGGACTATAGG - Intergenic
1018946523 6:168350315-168350337 GTGTACAACATGAGGACTGCGGG - Intergenic
1019255060 7:44298-44320 ATGGACGACATAAGGACTGTTGG + Intergenic
1019255069 7:44363-44385 ATGGACAACACAAGGACTGTTGG + Intergenic
1020588490 7:10103847-10103869 ACGTACAATATGAGGTCTATAGG + Intergenic
1020672325 7:11132165-11132187 ATATACAATATGAGGGCTACAGG - Intronic
1021893263 7:25208650-25208672 ATGTACAACATGAGGACTGTAGG - Intergenic
1022312494 7:29210256-29210278 CTGTAAGACATGAGGACTGTTGG + Intronic
1024514738 7:50236921-50236943 ACTAAAAATATGAGGACTGTAGG + Intergenic
1025293056 7:57748339-57748361 ATATACAACATGAGGACTATAGG + Intergenic
1025551610 7:62256387-62256409 ATGTGCACTGTGAGGTCTGTGGG + Intergenic
1025557348 7:62325114-62325136 ATGTGCACTCTGAGGTCTGTGGG + Intergenic
1025886529 7:65599583-65599605 ATGTGCAATGTGTGCACTGTGGG - Intergenic
1026364377 7:69633033-69633055 ATGTACAACATGAGGACTAAAGG - Intronic
1027991229 7:85363669-85363691 TTGTACAACATGATGACTGTAGG - Intergenic
1031855894 7:126922353-126922375 ATGTGCAATGTGTGTACTGTGGG + Intronic
1032695468 7:134332222-134332244 ATGTACAACATGAGGACTATAGG - Intergenic
1033048020 7:137980025-137980047 ATGTAAAATTTGAGAACTGCTGG - Intronic
1033326977 7:140388006-140388028 TTGTACAATATGGTGACTATAGG - Intronic
1033938056 7:146613614-146613636 CTGTTCAATATGAGAACTATAGG + Intronic
1034109424 7:148521906-148521928 ATGTCCAATATTAAGTCTGTTGG - Intergenic
1038871575 8:31500527-31500549 ATGCACAAGATGAAGACTATAGG - Intergenic
1039140293 8:34379830-34379852 ATGTACAACATGGGCACTATAGG + Intergenic
1040421844 8:47247742-47247764 ATGTACAACATGAGGACTACAGG - Intergenic
1041565396 8:59272023-59272045 ATGTGCTGCATGAGGACTGTGGG - Intergenic
1043472216 8:80574176-80574198 AGGCTCAATATGAGGACTGCAGG + Intergenic
1044002368 8:86899247-86899269 ATATACGATATGAGGATTATAGG + Intronic
1044049073 8:87476967-87476989 ATGTATAACAGGAGGACTATAGG + Intronic
1044061224 8:87638496-87638518 AATTACTATATGAGGACTTTTGG - Intergenic
1044145056 8:88702718-88702740 ATGTACTACTTGAGGACTATAGG - Intergenic
1045792726 8:106003883-106003905 ATGTACAACATGAGAACTACAGG + Intergenic
1045952483 8:107866963-107866985 CTGTGCAAAATGAGGACTGTGGG + Intergenic
1046495215 8:115005348-115005370 ATATACCACATGAGGACTATAGG - Intergenic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1048625906 8:136184637-136184659 ATGTACAATTAGAGGCCTGGAGG - Intergenic
1049126143 8:140790345-140790367 ATATACAAAATGAGGAATCTAGG + Intronic
1050762963 9:9096151-9096173 ATGTGCAACATGAGGACTATAGG + Intronic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1052189814 9:25646885-25646907 ATGTGCAATATGGGGAAAGTGGG - Intergenic
1054163477 9:61697560-61697582 ATATACAACATGAGGACTATAGG - Intergenic
1055870153 9:80867438-80867460 ATATACAACAGGAGGACTATAGG - Intergenic
1056429818 9:86516258-86516280 ATGTACAACATGGGGACTATAGG - Intergenic
1058251348 9:102699480-102699502 ATGTACAGCATGAGAATTGTAGG + Intergenic
1058733360 9:107871605-107871627 ATGTACAACATGAGGACTATAGG - Intergenic
1059141809 9:111860230-111860252 ATGTACAACATAAGGATTATAGG - Intergenic
1059637968 9:116189198-116189220 ATGTATAGCATGAGGACTATAGG + Intronic
1059899137 9:118903255-118903277 ATATACAACATGAGGACTCTAGG + Intergenic
1060151387 9:121290785-121290807 ATGTGCAACATGAGGACTATAGG - Intronic
1203718937 Un_KI270742v1:185540-185562 ATGTACAACATGAGGACTGTAGG + Intergenic
1203653171 Un_KI270751v1:149215-149237 ATGTACAACATGAGGACTGTAGG + Intergenic
1186694541 X:12016262-12016284 AGGAAAAATATGAGGTCTGTGGG + Intergenic
1187137334 X:16560863-16560885 ATGTACAGTGTGAGGAGTGGGGG + Intergenic
1187362275 X:18640106-18640128 GTGTACAATTTGATGACTTTTGG - Exonic
1187377158 X:18765379-18765401 GTGTACAACACGAGGACTATAGG + Intronic
1187621125 X:21056410-21056432 GTGTACAACATGAGAACTATAGG - Intergenic
1189169020 X:38891198-38891220 ATCTACAAAATGAGGATTATAGG + Intergenic
1190102998 X:47537091-47537113 TTATACAATATGTGAACTGTTGG - Intergenic
1190124548 X:47692141-47692163 ATGTACAACATGAGGACTATAGG + Intergenic
1193826841 X:86236734-86236756 ATGAACAATATGTGGACTGCAGG + Intronic
1194227651 X:91280557-91280579 ATGTAAAATATGTGAAGTGTGGG + Intergenic
1195300174 X:103521940-103521962 ATGTTGGATATGAGGACTGGTGG - Intergenic
1196051121 X:111305469-111305491 ATATAAAATATGAGGACTATAGG - Intronic
1196361148 X:114861105-114861127 ATGTACAACATGTGGACGATAGG - Intronic
1196391894 X:115216288-115216310 ATGTGCAAGATGATGAGTGTTGG + Intronic
1197179293 X:123517238-123517260 ATGTACATCATGAGTACTCTGGG + Intergenic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1197427943 X:126321456-126321478 ATGTACAATATGGTGTCTTTGGG - Intergenic
1197761497 X:130031206-130031228 ATGTACAATGGCAGGACTGGAGG - Intronic
1198410024 X:136357269-136357291 ATCTGTAAGATGAGGACTGTTGG + Intronic