ID: 959677756 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:109055696-109055718 |
| Sequence | TTAGTTCCTGGAACAGGGCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 387 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 25, 4: 358} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959677756_959677761 | 4 | Left | 959677756 | 3:109055696-109055718 | CCAAGCCCTGTTCCAGGAACTAA | 0: 1 1: 0 2: 3 3: 25 4: 358 |
||
| Right | 959677761 | 3:109055723-109055745 | ATGGTGAGAACCAGAAATACAGG | 0: 1 1: 0 2: 1 3: 22 4: 234 |
||||
| 959677756_959677763 | 14 | Left | 959677756 | 3:109055696-109055718 | CCAAGCCCTGTTCCAGGAACTAA | 0: 1 1: 0 2: 3 3: 25 4: 358 |
||
| Right | 959677763 | 3:109055733-109055755 | CCAGAAATACAGGTTCCCCCTGG | 0: 1 1: 0 2: 1 3: 8 4: 138 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959677756 | Original CRISPR | TTAGTTCCTGGAACAGGGCT TGG (reversed) | Intronic | ||