ID: 959677756

View in Genome Browser
Species Human (GRCh38)
Location 3:109055696-109055718
Sequence TTAGTTCCTGGAACAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959677756_959677763 14 Left 959677756 3:109055696-109055718 CCAAGCCCTGTTCCAGGAACTAA 0: 1
1: 0
2: 3
3: 25
4: 358
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138
959677756_959677761 4 Left 959677756 3:109055696-109055718 CCAAGCCCTGTTCCAGGAACTAA 0: 1
1: 0
2: 3
3: 25
4: 358
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959677756 Original CRISPR TTAGTTCCTGGAACAGGGCT TGG (reversed) Intronic