ID: 959677757

View in Genome Browser
Species Human (GRCh38)
Location 3:109055701-109055723
Sequence TATTCTTAGTTCCTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959677757_959677761 -1 Left 959677757 3:109055701-109055723 CCCTGTTCCAGGAACTAAGAATA 0: 1
1: 1
2: 5
3: 35
4: 320
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234
959677757_959677763 9 Left 959677757 3:109055701-109055723 CCCTGTTCCAGGAACTAAGAATA 0: 1
1: 1
2: 5
3: 35
4: 320
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959677757 Original CRISPR TATTCTTAGTTCCTGGAACA GGG (reversed) Intronic