ID: 959677758 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:109055702-109055724 |
| Sequence | ATATTCTTAGTTCCTGGAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 222 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 28, 4: 192} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959677758_959677763 | 8 | Left | 959677758 | 3:109055702-109055724 | CCTGTTCCAGGAACTAAGAATAT | 0: 1 1: 1 2: 0 3: 28 4: 192 |
||
| Right | 959677763 | 3:109055733-109055755 | CCAGAAATACAGGTTCCCCCTGG | 0: 1 1: 0 2: 1 3: 8 4: 138 |
||||
| 959677758_959677761 | -2 | Left | 959677758 | 3:109055702-109055724 | CCTGTTCCAGGAACTAAGAATAT | 0: 1 1: 1 2: 0 3: 28 4: 192 |
||
| Right | 959677761 | 3:109055723-109055745 | ATGGTGAGAACCAGAAATACAGG | 0: 1 1: 0 2: 1 3: 22 4: 234 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959677758 | Original CRISPR | ATATTCTTAGTTCCTGGAAC AGG (reversed) | Intronic | ||