ID: 959677760

View in Genome Browser
Species Human (GRCh38)
Location 3:109055708-109055730
Sequence CTCACCATATTCTTAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959677760_959677768 28 Left 959677760 3:109055708-109055730 CCAGGAACTAAGAATATGGTGAG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 959677768 3:109055759-109055781 TGAAGTTTCTCTTTTACCGAAGG 0: 1
1: 0
2: 4
3: 27
4: 199
959677760_959677763 2 Left 959677760 3:109055708-109055730 CCAGGAACTAAGAATATGGTGAG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138
959677760_959677761 -8 Left 959677760 3:109055708-109055730 CCAGGAACTAAGAATATGGTGAG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234
959677760_959677769 29 Left 959677760 3:109055708-109055730 CCAGGAACTAAGAATATGGTGAG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 959677769 3:109055760-109055782 GAAGTTTCTCTTTTACCGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959677760 Original CRISPR CTCACCATATTCTTAGTTCC TGG (reversed) Intronic