ID: 959677761

View in Genome Browser
Species Human (GRCh38)
Location 3:109055723-109055745
Sequence ATGGTGAGAACCAGAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959677760_959677761 -8 Left 959677760 3:109055708-109055730 CCAGGAACTAAGAATATGGTGAG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234
959677758_959677761 -2 Left 959677758 3:109055702-109055724 CCTGTTCCAGGAACTAAGAATAT 0: 1
1: 1
2: 0
3: 28
4: 192
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234
959677756_959677761 4 Left 959677756 3:109055696-109055718 CCAAGCCCTGTTCCAGGAACTAA 0: 1
1: 0
2: 3
3: 25
4: 358
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234
959677757_959677761 -1 Left 959677757 3:109055701-109055723 CCCTGTTCCAGGAACTAAGAATA 0: 1
1: 1
2: 5
3: 35
4: 320
Right 959677761 3:109055723-109055745 ATGGTGAGAACCAGAAATACAGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959677761 Original CRISPR ATGGTGAGAACCAGAAATAC AGG Intronic