ID: 959677763

View in Genome Browser
Species Human (GRCh38)
Location 3:109055733-109055755
Sequence CCAGAAATACAGGTTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959677756_959677763 14 Left 959677756 3:109055696-109055718 CCAAGCCCTGTTCCAGGAACTAA 0: 1
1: 0
2: 3
3: 25
4: 358
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138
959677757_959677763 9 Left 959677757 3:109055701-109055723 CCCTGTTCCAGGAACTAAGAATA 0: 1
1: 1
2: 5
3: 35
4: 320
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138
959677760_959677763 2 Left 959677760 3:109055708-109055730 CCAGGAACTAAGAATATGGTGAG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138
959677758_959677763 8 Left 959677758 3:109055702-109055724 CCTGTTCCAGGAACTAAGAATAT 0: 1
1: 1
2: 0
3: 28
4: 192
Right 959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959677763 Original CRISPR CCAGAAATACAGGTTCCCCC TGG Intronic