ID: 959679135

View in Genome Browser
Species Human (GRCh38)
Location 3:109072705-109072727
Sequence GGATATCTTCAGAAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959679133_959679135 16 Left 959679133 3:109072666-109072688 CCACTTAGGAAAGGGAGATAAAA 0: 1
1: 0
2: 0
3: 29
4: 328
Right 959679135 3:109072705-109072727 GGATATCTTCAGAAGATGAAAGG 0: 1
1: 0
2: 3
3: 14
4: 284
959679132_959679135 20 Left 959679132 3:109072662-109072684 CCGTCCACTTAGGAAAGGGAGAT 0: 1
1: 0
2: 0
3: 25
4: 189
Right 959679135 3:109072705-109072727 GGATATCTTCAGAAGATGAAAGG 0: 1
1: 0
2: 3
3: 14
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959679135 Original CRISPR GGATATCTTCAGAAGATGAA AGG Intronic
900870509 1:5298840-5298862 GGATATGTTTTGAAGATGACAGG + Intergenic
905214650 1:36398185-36398207 AAATTTCTTCAGAAGATTAAAGG + Intergenic
906228704 1:44141965-44141987 AGATCTCTTCAGAGGATGATAGG - Intergenic
906891628 1:49722234-49722256 TTATATCTTCAGAAAAAGAAAGG - Intronic
907469848 1:54666205-54666227 GCAGACCTTCAGAGGATGAAGGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909274062 1:73662428-73662450 AGATGTCTTCAGTAGGTGAATGG - Intergenic
909666227 1:78136180-78136202 GGATATGTTCAGGAAATGAAAGG + Exonic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910615628 1:89195215-89195237 AGATATGTACAGAAGTTGAAGGG + Intronic
910621348 1:89259330-89259352 GAGATTCTTCAGAAGATGAAAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911542973 1:99181213-99181235 AAATGTCTTCAGAAGACGAAAGG - Intergenic
912005338 1:104892101-104892123 GGATATGTTCAGAAAACTAAAGG + Intergenic
913201343 1:116497307-116497329 GAATAATTTAAGAAGATGAAGGG + Intergenic
913474119 1:119220251-119220273 GATTATCTTCAGAAGATGCTAGG - Intergenic
914877575 1:151523658-151523680 GGAAATCTCCAGAAGCTGAAAGG + Intronic
915404612 1:155650096-155650118 GGGGTTCTTGAGAAGATGAAGGG + Intergenic
915419058 1:155765284-155765306 GGGGCTCTTGAGAAGATGAAGGG + Exonic
916008785 1:160685733-160685755 GCAAACCTTCAGAAGGTGAAGGG - Intronic
916303823 1:163306280-163306302 GGATATCTTCAGAGGGAAAAAGG - Intronic
917773781 1:178311095-178311117 GGACATCTGGAGGAGATGAATGG + Intronic
918615331 1:186537772-186537794 GAATCTCCTGAGAAGATGAAGGG - Intergenic
919150047 1:193684868-193684890 GGATATATTCAAAAGAAAAATGG + Intergenic
919566234 1:199192361-199192383 GGATATATTCAGAAAAATAAAGG + Intergenic
921127710 1:212192387-212192409 AGACATCTTCAGTAGGTGAATGG + Intergenic
922175944 1:223197789-223197811 GGATCTATCCAGAGGATGAAAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924204071 1:241693162-241693184 AGAAATCTTCAGTAGCTGAATGG + Intronic
924458227 1:244235050-244235072 TGTTATCATCAGAAAATGAAGGG + Intergenic
924588641 1:245382075-245382097 GGATATATCCAGAAGTAGAACGG + Intronic
924657794 1:245989209-245989231 GGATTTCTTAAGAAGAGAAAGGG - Intronic
1063065766 10:2606714-2606736 GGCTGTCTTCACAACATGAAAGG - Intergenic
1064128340 10:12684752-12684774 GAATATATTCAGAAGATGTTGGG + Intronic
1064765716 10:18669245-18669267 GAAAATCTTGTGAAGATGAATGG - Intronic
1066093161 10:32046416-32046438 TGACATCTTCATAAAATGAAGGG - Intronic
1066762300 10:38767066-38767088 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1068072698 10:52215672-52215694 GGATAACTTTAAAATATGAAAGG + Intronic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1074328638 10:112479676-112479698 GATTATTTTCAGAAGTTGAATGG - Intronic
1075952549 10:126494185-126494207 GTGTATATTCAGCAGATGAACGG - Intronic
1079252595 11:18797883-18797905 GGATAATTTCAGACAATGAAAGG + Intergenic
1080751206 11:35152048-35152070 GGAAAGCTTTTGAAGATGAAAGG + Intronic
1081702825 11:45162721-45162743 GTATAGCTTCAGAGGATGTATGG + Intronic
1087739676 11:101872962-101872984 GGATATCTTTGGAATATCAAAGG - Intergenic
1087938939 11:104070059-104070081 GGATATCTTCAAAGAATGATGGG - Intronic
1091100153 11:132864330-132864352 GCAAACCTTCAGAAGGTGAAGGG + Intronic
1091253410 11:134163156-134163178 GGGTTTATTCAGAAGATGACAGG + Intronic
1091743002 12:2973459-2973481 GAAAATCTTCACAAGATGATGGG + Intronic
1092276094 12:7061958-7061980 GCTTTTCTTGAGAAGATGAAGGG - Intronic
1095338205 12:41055554-41055576 AGATCTCTTGAGAAGAAGAAAGG + Intronic
1095484849 12:42674193-42674215 GGATGAGTTCAGATGATGAAGGG - Intergenic
1097024538 12:56044894-56044916 GGATAGCTTCAGAGCATAAAAGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098952606 12:76657253-76657275 TGATTTCTTCAGAAAATGAGAGG + Intergenic
1101098733 12:101370547-101370569 GCATACCTTCAGAAGACCAAAGG - Exonic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1102177308 12:110885637-110885659 GGATTTCATCAGAAGAGAAAAGG - Intronic
1104253391 12:127117840-127117862 TGGTATCATCAGAAGAGGAAAGG + Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1105828083 13:24140366-24140388 GGATATTTTCAAAATATAAAAGG + Intronic
1107664409 13:42674222-42674244 GTATATCAGAAGAAGATGAAGGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108162431 13:47655817-47655839 GGATTACTTCAGCAAATGAATGG - Intergenic
1108777111 13:53780243-53780265 GGATAACTGTAGAAGATGCAGGG - Intergenic
1110601125 13:77375269-77375291 GGACCTCTTCAGAAGAAGATCGG - Intergenic
1111148187 13:84212727-84212749 TCATATCCTCAGAAGATGTAGGG - Intergenic
1112023200 13:95389970-95389992 GGATGACATCAGAGGATGAATGG - Intergenic
1113252037 13:108464061-108464083 AGAAATCTTCAGAGGAGGAAGGG + Intergenic
1113307881 13:109097490-109097512 GGGTTTCTGCAGAAGAAGAAAGG - Intronic
1113606192 13:111609043-111609065 TGCTAACTTCAAAAGATGAAGGG + Intronic
1114254045 14:20986681-20986703 TGATATCCTCAGAAGATGAATGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1121472697 14:94167564-94167586 GGACAACTTTAGAAGAGGAAAGG + Intronic
1122430526 14:101637484-101637506 TGATATTTTTAGTAGATGAAGGG + Intergenic
1202933634 14_KI270725v1_random:63319-63341 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1124994936 15:34714310-34714332 GGACATTATCAGAAAATGAAAGG - Intergenic
1126078968 15:44939817-44939839 GGATTTCTAGAGAATATGAAGGG + Intergenic
1127470958 15:59289646-59289668 GGCAATCTCCAGAAGATGAGGGG + Intronic
1128717619 15:69920153-69920175 GGATTTCTTGAGGAGATGACTGG + Intergenic
1128734645 15:70046362-70046384 GGATTTCTGCATAAGAGGAAAGG + Intergenic
1128851436 15:70961499-70961521 AGATGTCCTCAGAAGGTGAATGG + Intronic
1129658432 15:77539952-77539974 GTACATCTTCAGGAGATGAGGGG - Intergenic
1131788309 15:95936753-95936775 GGATATCATTATATGATGAAAGG - Intergenic
1131820115 15:96263918-96263940 GCATATCCTCAGAAGAGGAATGG - Intergenic
1133618174 16:7499274-7499296 GCATACCATCTGAAGATGAATGG - Intronic
1138939474 16:61773112-61773134 GAATATCTTCTGAAGATGAGGGG - Intronic
1140589925 16:76339665-76339687 AGATAACTTCAGAAGGTCAAAGG - Intronic
1141312146 16:82925047-82925069 GGATCTCTTAAGATGATTAATGG - Intronic
1145199971 17:20935446-20935468 GGTTATCTTCAGGAAAGGAACGG + Intergenic
1148004866 17:44418822-44418844 GGATTTCTTCAGAAATGGAAAGG + Intronic
1148318684 17:46729118-46729140 TGATTTCTTCAGAAAAGGAATGG - Intronic
1148961127 17:51393790-51393812 GGATAACCTCAGAAGAGAAAGGG - Intergenic
1149357142 17:55851658-55851680 AGTTTTCTTCATAAGATGAAGGG + Intergenic
1149646004 17:58242146-58242168 GAATCTCCTCAGAAGATGTATGG + Intronic
1150123753 17:62623390-62623412 GGAGATGTTCAGAAAATGCAGGG + Intergenic
1151413706 17:73947862-73947884 GGATATGGTCAGATGCTGAATGG + Intergenic
1154302356 18:13205330-13205352 AGATGTCTTCAGTAGGTGAATGG - Intergenic
1154931434 18:21001028-21001050 GTATATCATCAACAGATGAATGG + Intronic
1156354692 18:36331005-36331027 GGCTATCATCAGAACAGGAATGG - Intronic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1157445189 18:47739128-47739150 GTATATCTTTAGATGATAAAGGG - Intergenic
1157561110 18:48647077-48647099 GGTGATCTTCAGCAGATGAATGG + Intronic
1157842671 18:50973809-50973831 GTATATGTTCAGAAGCTTAAGGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1163871172 19:19822363-19822385 GAATATATTCAAAAGGTGAACGG + Intergenic
1163916075 19:20241866-20241888 GAATGTATTCAAAAGATGAACGG - Intergenic
1165428047 19:35756400-35756422 CGATATCTCCAGAAGAGGAGGGG - Intronic
1168633638 19:57976724-57976746 TGAAATCTTCTGCAGATGAAAGG - Intergenic
925292689 2:2758261-2758283 GGACATCTTCACATGATGACAGG - Intergenic
925616228 2:5746912-5746934 GGATATACTCAGATGAAGAAGGG - Intergenic
925620739 2:5790519-5790541 GGAAATGTTCAGAAGATTAGAGG - Intergenic
926276525 2:11407384-11407406 GGCTAACTGCAGAAGGTGAATGG + Intergenic
926551246 2:14303499-14303521 GGTTATCTACTGAAGAGGAATGG - Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
930201019 2:48552097-48552119 GGTTTTCATCAGCAGATGAATGG + Intronic
931183110 2:59923409-59923431 GGATGTCTTCAGAACAGGGAGGG + Intergenic
931497187 2:62820810-62820832 GGATATTTTCAAAAAGTGAAGGG + Intronic
932182234 2:69657827-69657849 GCATTTATTCACAAGATGAATGG + Intronic
932414802 2:71566973-71566995 GGGTGGGTTCAGAAGATGAAAGG - Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934325613 2:92011681-92011703 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934463968 2:94242311-94242333 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934700333 2:96434577-96434599 GGATATCTTCAATATATGATTGG + Intergenic
934726511 2:96623880-96623902 GGAAAGCTTCTGAAGATGGAGGG - Intronic
935441062 2:103095610-103095632 AGATATCTTCAGTAAATGAATGG + Intergenic
939798056 2:146672409-146672431 GGTAACCTTCAAAAGATGAATGG + Intergenic
942839323 2:180340508-180340530 GGATACCACCTGAAGATGAATGG - Intergenic
943525813 2:189015968-189015990 GAATATACTCAGAAGGTGAATGG - Intergenic
943759632 2:191593705-191593727 GCATACCTACAGAAGATGACGGG + Intergenic
944027430 2:195188085-195188107 AGATATTTTCAGAAAGTGAAGGG + Intergenic
945323534 2:208455740-208455762 AAATATCTTCAAAGGATGAATGG + Intronic
946130089 2:217599978-217600000 GGATTTGTTCAGCAGTTGAATGG - Intronic
947376882 2:229505040-229505062 TGATATGTTCATAACATGAAGGG + Intronic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169736628 20:8844767-8844789 GCATATGTTCAGAGGATAAAAGG - Intronic
1170947542 20:20904875-20904897 GGTTATTTTCAGAAGAAGAAGGG - Intergenic
1173890473 20:46505061-46505083 GGACATATACACAAGATGAAGGG + Intronic
1174890894 20:54391225-54391247 CTATATCTTCATAAGTTGAAAGG - Intergenic
1174999104 20:55606786-55606808 GAATGTCATGAGAAGATGAAGGG - Intergenic
1176595034 21:8685475-8685497 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1176686311 21:9851327-9851349 GAATATTTTCAGAAGAAGGAAGG - Intergenic
1176956586 21:15111421-15111443 GGATATTTTCAGCAGTAGAATGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177828581 21:26111424-26111446 AGATATATACTGAAGATGAAAGG + Intronic
1177982497 21:27931800-27931822 GGATATAAGCAGAAGATGGATGG - Intergenic
1178295225 21:31404194-31404216 GGATATTTTCTAAAGATAAAAGG - Intronic
1180277887 22:10662633-10662655 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1180585121 22:16881466-16881488 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1183002844 22:34875962-34875984 GGATAACATCCCAAGATGAATGG - Intergenic
1185379380 22:50500858-50500880 GGGTTTCTTCTGGAGATGAAAGG + Intergenic
950367669 3:12499543-12499565 AGGTTTCTTGAGAAGATGAAAGG - Intronic
950511913 3:13434525-13434547 GCAAAACTTCAGAGGATGAAAGG + Intergenic
951072687 3:18351110-18351132 GAGTGTCTTCAGGAGATGAATGG + Intronic
951284377 3:20791086-20791108 GAATCTCTGCACAAGATGAATGG - Intergenic
951292222 3:20885563-20885585 ATATATCTAAAGAAGATGAATGG - Intergenic
951345929 3:21547028-21547050 GGATACAGGCAGAAGATGAATGG - Intronic
951589956 3:24253861-24253883 GCATAGCTTCATAAGATGACAGG - Intronic
951733862 3:25841080-25841102 GGATTTATTCCTAAGATGAAAGG + Intergenic
951989708 3:28663087-28663109 GCATATCTTGAGAAAATGAATGG + Intergenic
952579897 3:34820864-34820886 GCAGACCTTCAGAGGATGAAGGG + Intergenic
953776768 3:45824950-45824972 GGCAGTCTTAAGAAGATGAATGG - Exonic
954020945 3:47740636-47740658 GGATGTATTAAGAACATGAAAGG - Intronic
956081688 3:65564056-65564078 GCATATCTCCAGAGGCTGAAAGG + Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957484713 3:80843982-80844004 GATGATCTTCAGAGGATGAAAGG + Intergenic
957870166 3:86081983-86082005 GAATATTTTGAGCAGATGAAGGG + Intergenic
959679135 3:109072705-109072727 GGATATCTTCAGAAGATGAAAGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
964205531 3:154170815-154170837 GGATATCTTTTGAGAATGAAAGG - Intronic
964345347 3:155749514-155749536 GGATTTGTTCCCAAGATGAAAGG + Intergenic
964666045 3:159173628-159173650 GAATATCTTCAAAGTATGAAGGG - Intronic
965563081 3:170080492-170080514 GAACCTCTTCAGAAGATGACTGG - Intronic
967654823 3:192034391-192034413 TGATATCTGAATAAGATGAATGG + Intergenic
968033319 3:195522734-195522756 GGCTATATTCTGAAGATGATAGG + Intronic
969504363 4:7575007-7575029 AGATATCTTCAGAATATGAGAGG + Intronic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
973875693 4:55216364-55216386 GGATATGTCCAGAAGAGGAACGG + Intergenic
974183611 4:58416266-58416288 GGTTATCTTGAGTAGAGGAAGGG + Intergenic
974527939 4:63069028-63069050 ATACATCTTCAGTAGATGAAGGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975834579 4:78408800-78408822 GGAGACCTTCAGTAGATTAAAGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
980791595 4:137627849-137627871 TGAGATCTTCAGAAAAAGAAAGG + Intergenic
981861833 4:149364588-149364610 GGATGTCTGCACCAGATGAAAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982634301 4:157873150-157873172 AGATATCTTCAGAGAAGGAAAGG - Intergenic
984608611 4:181812980-181813002 GGTTATCTTCAAGAGATGGAAGG - Intergenic
984645433 4:182214369-182214391 GGAAATCTTGAAAAGTTGAATGG + Intronic
985378664 4:189369923-189369945 GCATCTCTTCATGAGATGAATGG + Intergenic
987096998 5:14559054-14559076 GAATATATTCAGCAGTTGAAGGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
989184852 5:38613796-38613818 TGACCTCTTCAGTAGATGAAAGG + Intergenic
991510034 5:67365935-67365957 GGTTATCCTCAAAAGAGGAAAGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992871193 5:81007193-81007215 GGAAACCTGCAGAAGGTGAAGGG + Intronic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
994427387 5:99607826-99607848 GGATAGGATAAGAAGATGAAGGG + Intergenic
994907173 5:105856041-105856063 GGAGATCTTCAGAGGAAAAAGGG + Intergenic
995170357 5:109103940-109103962 TGATATCTTCAGAAAGTAAAAGG + Intronic
995568913 5:113458901-113458923 GCAAAGGTTCAGAAGATGAAAGG + Intronic
995896703 5:117021177-117021199 AGATATAATTAGAAGATGAAGGG - Intergenic
997142567 5:131398277-131398299 GGTAATCTTCAAAAGTTGAAGGG - Intronic
998726106 5:145016536-145016558 GATTATCTTCTGAACATGAAAGG + Intergenic
999337305 5:150733121-150733143 GGAAATAATCAGAAGATAAAGGG + Intronic
999897072 5:156046219-156046241 GAATATCTATAGAAGATGCAAGG + Intronic
1000043957 5:157506108-157506130 ATATATGTTCAGAAGAAGAATGG - Intronic
1000849028 5:166317518-166317540 TGATATCTTCAGAAATTGTATGG + Intergenic
1001738406 5:174027384-174027406 AGATGTCTTCAAGAGATGAACGG + Intergenic
1002907855 6:1465419-1465441 GCAAACCTTCAGAGGATGAAGGG - Intergenic
1002910938 6:1490539-1490561 AGCTATCTGCAGGAGATGAAAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1004125015 6:12864838-12864860 GGATTTCTTCAGTAGCTTAAAGG + Intronic
1007677955 6:43613714-43613736 TGATGTCTGTAGAAGATGAAGGG - Exonic
1008834071 6:55805086-55805108 AGATTTCATCAAAAGATGAATGG - Intronic
1009019977 6:57938674-57938696 GGATCTCTGCAGCAGATGCAAGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1010302620 6:74279885-74279907 GGATGTCTTCTTATGATGAAGGG + Intergenic
1011073172 6:83408135-83408157 GGATAAAATCAGATGATGAATGG + Intronic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014916338 6:127153557-127153579 GTTTATAGTCAGAAGATGAAAGG - Intronic
1015982908 6:138857113-138857135 GGAAGTCTGGAGAAGATGAAAGG - Intronic
1018526846 6:164721442-164721464 GGATATTTTATGAAGATAAATGG - Intergenic
1018884909 6:167927164-167927186 GGAGAAATTAAGAAGATGAATGG + Intronic
1019063893 6:169279204-169279226 ACATATCTACAGAAAATGAACGG - Intergenic
1019843084 7:3468894-3468916 GCATACCTTCAGAGGGTGAAGGG + Intronic
1020881769 7:13770390-13770412 GAATGTCTTCACAAAATGAAGGG + Intergenic
1021683684 7:23160035-23160057 GGAAGAGTTCAGAAGATGAAGGG - Intronic
1022567531 7:31418120-31418142 TAATATCTTCAGAAAATGCAAGG - Intergenic
1023168686 7:37368963-37368985 GCAAACCTTCAGGAGATGAAGGG + Intronic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028653563 7:93176220-93176242 GGATTTATTCTGAATATGAAAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031273700 7:119689411-119689433 AGATATCTGAAGAAGTTGAATGG + Intergenic
1032480888 7:132245988-132246010 GAAAATGTTCAGAAGATGGAGGG + Intronic
1037345035 8:17889669-17889691 GGATATCCCCAGAGGCTGAATGG - Intronic
1038976866 8:32707917-32707939 ATATAACTTCAGAAGATGATGGG - Intronic
1040876828 8:52161841-52161863 TGATATCTTCATAAGATGAATGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042500513 8:69503702-69503724 GGACCTCTTCAGAAGATGAAGGG - Intronic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044789389 8:95832197-95832219 GGTGTTCTTCAGTAGATGAATGG + Intergenic
1045082331 8:98640544-98640566 AGATATTTTCATAAGAAGAATGG - Intronic
1045705811 8:104921172-104921194 GAACATCATCAGAAGATGCAGGG + Intronic
1046012364 8:108564938-108564960 GGATATATTCAGTAGTAGAATGG - Intergenic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046659122 8:116929523-116929545 GGGAACCTTCAGAAGGTGAACGG + Intergenic
1046699751 8:117386842-117386864 AAATGTCTTCAGAAGGTGAAAGG - Intergenic
1047245869 8:123143907-123143929 GGATTTCTGCAGAACGTGAAGGG - Intronic
1051334755 9:16055686-16055708 GGCTATGTTCAGCAGATGCAAGG - Intronic
1051473030 9:17471459-17471481 GGATATTGTCAAAATATGAATGG - Intronic
1051993534 9:23184041-23184063 GGATGTCTCAAGAAGATGTAAGG + Intergenic
1052423140 9:28270072-28270094 GGGTATCTTCAGAACCTTAAAGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052548578 9:29915225-29915247 GGATATCTTAACCAGATAAATGG - Intergenic
1053534264 9:38910528-38910550 GGATATCCTGAGAGGATGACAGG - Intergenic
1053694059 9:40619109-40619131 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1053941049 9:43249528-43249550 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054206488 9:62134947-62134969 GGATATCCTGAGAGGATGACAGG - Intergenic
1054270776 9:63021018-63021040 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054305304 9:63418333-63418355 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054404051 9:64742322-64742344 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054437672 9:65227822-65227844 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054492731 9:65794145-65794167 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054631870 9:67453399-67453421 GGATATCCTGAGAGGATGACAGG + Intergenic
1058400351 9:104610190-104610212 GGAAATATTCTGAAGATAAAAGG - Intergenic
1059599783 9:115764628-115764650 GGATATTATCAGTAGATAAAGGG + Intergenic
1060391237 9:123278913-123278935 GGATATGTTCTAAAGATAAAGGG + Intergenic
1185859249 X:3562416-3562438 GGACATTTTCAGTAGATGAATGG - Intergenic
1186736221 X:12467352-12467374 GGATTTCTCCTCAAGATGAAAGG + Intronic
1187666928 X:21623781-21623803 GCATATTGTCAGAAGAAGAAAGG + Intronic
1188216331 X:27481800-27481822 GGATGTCTTCAGAAAAATAATGG + Intergenic
1188591038 X:31835391-31835413 GGCTTTCTTCAGAACATCAACGG + Intronic
1189427348 X:40913010-40913032 GGATACCTACAGGAGATGGAAGG - Intergenic
1189555753 X:42143817-42143839 GAATAGCTTCAGAAGACAAATGG + Intergenic
1189568383 X:42268632-42268654 GGAAATGTTCTGGAGATGAATGG - Intergenic
1189749092 X:44200909-44200931 GAGTATCTTCAAAAGATCAAAGG + Intronic
1190004428 X:46721588-46721610 GGTTATCTTCAGATGCTGCATGG + Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193536298 X:82719566-82719588 GGATGTCTTCAGTAGGTGAATGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194867933 X:99091799-99091821 GGGTCTTTTCAGAAGGTGAAGGG + Intergenic
1195369401 X:104158237-104158259 GGTTCTCTTCAGAAGCAGAAGGG + Intergenic
1195919878 X:109973478-109973500 GGCTTTTTTCAGAAAATGAAGGG + Intergenic
1196016791 X:110948162-110948184 TGAAATTTTCAGAATATGAAAGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197508429 X:127338815-127338837 GGATATATTCCAGAGATGAAAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198881175 X:141282712-141282734 GCCTGTCTTCAGAAGATCAAAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200806793 Y:7442007-7442029 GGACATTTTCAGGAGATGAATGG + Intergenic
1201191830 Y:11450662-11450684 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic