ID: 959682459

View in Genome Browser
Species Human (GRCh38)
Location 3:109111344-109111366
Sequence AGGTTGCCTCAGCACTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959682457_959682459 -2 Left 959682457 3:109111323-109111345 CCATTCATTACATAGTATCTAAG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 959682459 3:109111344-109111366 AGGTTGCCTCAGCACTACAGTGG 0: 1
1: 0
2: 2
3: 9
4: 110
959682456_959682459 -1 Left 959682456 3:109111322-109111344 CCCATTCATTACATAGTATCTAA 0: 1
1: 0
2: 0
3: 25
4: 226
Right 959682459 3:109111344-109111366 AGGTTGCCTCAGCACTACAGTGG 0: 1
1: 0
2: 2
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959682459 Original CRISPR AGGTTGCCTCAGCACTACAG TGG Intronic
904649420 1:31993545-31993567 CTCTTGCCTCAGGACTACAGAGG + Intergenic
905930875 1:41786581-41786603 TGGCTGCTTCAGCCCTACAGCGG + Intronic
911015208 1:93324853-93324875 AAGTAGCCTCTGCATTACAGAGG - Intergenic
912796693 1:112697934-112697956 AGATTCCCTCTGCCCTACAGGGG - Intronic
914252976 1:145937034-145937056 AGGTTGCATCAGAATTACATGGG + Intronic
915079522 1:153342298-153342320 TGGTTTCCCCAGCACTCCAGAGG - Intronic
916048547 1:161018862-161018884 AGGTTCCCTCTGCACTACTGTGG + Intronic
916328451 1:163589962-163589984 ACGCTGCACCAGCACTACAGTGG - Intergenic
918161774 1:181907941-181907963 AGTTTGCCTCAGGGCTCCAGAGG - Intergenic
919541002 1:198845395-198845417 AGTTTGAATCAGCACTCCAGGGG + Intergenic
919928684 1:202207346-202207368 AGGTGGCCCCAGGACTAGAGGGG + Intronic
920459431 1:206127916-206127938 AGGATGCCTAGGCACTAGAGAGG - Intergenic
922015518 1:221642099-221642121 AGAAGGCCACAGCACTACAGAGG - Intergenic
922084666 1:222334765-222334787 TGGTTGTTTTAGCACTACAGTGG + Intergenic
924273462 1:242359334-242359356 AAGTTGCCACAGCACCACACAGG - Intronic
1065767033 10:29039742-29039764 CAATTGCCTCAGCACCACAGAGG + Intergenic
1066711255 10:38237320-38237342 AAGTTGCCACAGCACCACACAGG + Intergenic
1067940480 10:50650875-50650897 AGGTTCCCACAGCCTTACAGTGG - Intergenic
1069266547 10:66465565-66465587 AACTTGCCTCAGCATTGCAGAGG - Intronic
1069770569 10:70896683-70896705 AGGCTGCTTCAGCACAACATGGG - Intergenic
1069798754 10:71069588-71069610 AAGCTTCCTCAGCCCTACAGAGG + Intergenic
1074085091 10:110203842-110203864 AAGTAGCCTCCGCCCTACAGTGG - Intergenic
1076232854 10:128836205-128836227 AGGTTTCCCCATCACTACTGAGG - Intergenic
1094403330 12:30086251-30086273 AGGTGGCCACATTACTACAGGGG + Intergenic
1098128539 12:67323921-67323943 AGATTGCCTCAGAACTGCAGTGG + Intergenic
1103937189 12:124482952-124482974 GAGTTGGCTCAGCACTAAAGGGG - Intronic
1104905493 12:132211467-132211489 AGGTTGCCTCCTCACTGCTGTGG - Intronic
1108372846 13:49788076-49788098 AAGTTGCCTCAGCAGTAAATGGG + Intronic
1108474935 13:50805889-50805911 TGGTTGCTTCAGCACTACAGTGG + Intronic
1109177948 13:59178485-59178507 AGGCTTCCTCAGCACTTCATTGG - Intergenic
1113892473 13:113743664-113743686 AGGCTGCCTGAGCCCCACAGTGG + Intergenic
1116902784 14:50377716-50377738 AGCTTGCTTCGGCACTGCAGTGG + Intronic
1118911270 14:70064040-70064062 AGTTTGCCCCAACACCACAGGGG + Intronic
1120854686 14:89202394-89202416 AGATTGCCTCAGCAGAACAGTGG - Intronic
1122929365 14:104926312-104926334 AGGGTGCCTCACAAGTACAGAGG - Intronic
1124821862 15:33053788-33053810 AGCATGCCTCAGCTCCACAGGGG - Intronic
1130511668 15:84594782-84594804 AGATTCTCTCAGCACCACAGCGG - Intergenic
1130807532 15:87341543-87341565 AGGAAGACTCAGAACTACAGTGG - Intergenic
1133656142 16:7866346-7866368 TGGTTGCTTCATCACAACAGGGG - Intergenic
1133702995 16:8326457-8326479 AGGTAGTCTCAGCCCTACAAAGG - Intergenic
1137288531 16:47036291-47036313 CGGTTTCCTCATCACTAAAGTGG - Intergenic
1141947814 16:87322604-87322626 AGGTAGCCCCAGAACTGCAGGGG + Intronic
1143094956 17:4473870-4473892 AGGTTTCCGCACCACTCCAGGGG - Intronic
1144638651 17:16926028-16926050 AGGGGTCCTCAGCACTCCAGAGG - Intergenic
1144661770 17:17075596-17075618 ATGTTGCCTCTGCTCTGCAGAGG - Intronic
1145055967 17:19704225-19704247 AGGCTGGCTCAGGACTTCAGGGG - Intronic
1149569575 17:57663030-57663052 ATGTTGACTCATCCCTACAGAGG - Intronic
1150331340 17:64296852-64296874 AAGTTGCCTCATCATTAAAGTGG - Intergenic
1155629377 18:27874138-27874160 AGGTTGCTTCAGTCCTATAGAGG - Intergenic
1158554630 18:58465319-58465341 AGGCTGCCTTAGCTCTGCAGGGG - Intergenic
1159498194 18:69233300-69233322 AGGATGCATCTGTACTACAGTGG + Intergenic
1161282633 19:3454076-3454098 AGGCTGCCTCAGCCCTACATGGG - Intronic
1162570096 19:11466551-11466573 TGGTAGCCTCAGAAATACAGAGG - Intronic
1164608025 19:29613816-29613838 TGGTTCCCCCAGCACCACAGAGG + Intronic
1165601475 19:37058516-37058538 AGGTTGCCTCAGGGCTACCTAGG + Intronic
1168355907 19:55699583-55699605 CGGCTGCTTCTGCACTACAGTGG + Intronic
927509312 2:23634576-23634598 AGGTTCCCCCAGCTCCACAGAGG + Intronic
928364659 2:30691785-30691807 TTGTTGCCTCAGCACTGGAGAGG - Intergenic
929236585 2:39611534-39611556 AGGTTGCCTGAGGACTACATGGG - Intergenic
929364205 2:41132512-41132534 AGGTTGCTTCATCACTAATGAGG + Intergenic
930239226 2:48918702-48918724 AGGTTGCCTGTTCACTCCAGTGG + Intergenic
930320670 2:49850958-49850980 AGGTTGAATCAGAACTGCAGAGG - Intergenic
932327438 2:70872418-70872440 AGGTTGCCACAGCTCTACACTGG + Intergenic
932466864 2:71929654-71929676 AGGCTGCCTTTGCACTGCAGTGG + Intergenic
938493161 2:131776436-131776458 ACGTGGCCTCAGCTCTACGGAGG - Intergenic
938499320 2:131822217-131822239 ACGTGGCCTCAGCTCTACGGAGG + Intergenic
942183258 2:173400943-173400965 AGGTTCCCTTTGCCCTACAGGGG + Intergenic
943413376 2:187566956-187566978 ATGATGCCTGAGCTCTACAGTGG + Intergenic
946891306 2:224280049-224280071 ACTTTTCCTAAGCACTACAGGGG - Intergenic
948241013 2:236435018-236435040 AGGCTGCCTCAGCCCTCTAGAGG - Intronic
1175157775 20:56983852-56983874 ATGTTGAATCAGGACTACAGTGG + Intergenic
1175801944 20:61805945-61805967 AGCTTTCCACAGCACCACAGTGG - Intronic
1176710474 21:10145920-10145942 ATGTGGCCTCAGCTCTAGAGAGG - Intergenic
1179965254 21:44801196-44801218 AGGTTTCCTCAACACTACCTAGG + Intronic
1183513360 22:38248816-38248838 AGGAGGCCTCAGCAGTAAAGTGG - Intronic
1183946353 22:41328250-41328272 AGGTTTCATCCGCACCACAGCGG + Intronic
1184651688 22:45922211-45922233 AGGCTGCCTCAGCTCTGCAGGGG + Exonic
952242447 3:31546431-31546453 AGTCTGCCTCAGCATTGCAGCGG + Intronic
954498723 3:50989320-50989342 AGATTGCCCCAGAGCTACAGCGG + Intronic
955046646 3:55367272-55367294 ACTTTGCCTCAGCACCACAGAGG + Intergenic
959682459 3:109111344-109111366 AGGTTGCCTCAGCACTACAGTGG + Intronic
961777352 3:129297997-129298019 AGGTTGCTTCAGCAAGACACAGG + Intronic
969719315 4:8884636-8884658 AGCTGGCCTCTGCACTACTGAGG - Intergenic
972335867 4:38106855-38106877 AGGCTGCCTGAGCCCTGCAGGGG - Intronic
972695740 4:41444680-41444702 AGGTTCCATCAGCCCTAAAGAGG + Intronic
975452852 4:74550071-74550093 ATTATGCCTCAGCATTACAGTGG - Intergenic
975866946 4:78733714-78733736 AGGTTGTCTGGGCAATACAGTGG + Intergenic
978447338 4:108792014-108792036 AGGTAACCTCAGCACTTTAGAGG + Intergenic
978687867 4:111469595-111469617 AGCTTTCCTCAGCACCCCAGAGG + Intergenic
978806720 4:112808705-112808727 AGGTTGGTTGAGCACTACATAGG + Intergenic
979377374 4:119962948-119962970 AGGTTTCCTCAGCTCAACAATGG + Intergenic
988251207 5:28760179-28760201 AGGTTGCCTGTTCACTCCAGTGG - Intergenic
988254452 5:28803846-28803868 AGGTTGCCTGTTCACTCCAGTGG - Intergenic
994536663 5:101039551-101039573 AGGTTGCCTGTTCACTACACAGG - Intergenic
994644994 5:102457297-102457319 AGGTTGCCTGTTCACTCCAGTGG - Intronic
996662335 5:126019302-126019324 CGGGTGCCTCAGCATTACATTGG + Intergenic
1001709599 5:173767779-173767801 AGGTGGCCTCTGGCCTACAGTGG + Intergenic
1004237983 6:13891859-13891881 TGGCTGCCTCAGCACTGCAATGG - Intergenic
1005228527 6:23671769-23671791 AGCTTGGCTCACCACTCCAGAGG - Intergenic
1005971028 6:30761903-30761925 AGCTGGCTTCAGCACAACAGTGG - Intergenic
1006284387 6:33081556-33081578 AGGTGACCTCAGCAGCACAGTGG + Intronic
1008173305 6:48235035-48235057 AGATTGCCTCAGCACTTCAGTGG + Intergenic
1010370738 6:75104259-75104281 ATGTTACCTCACTACTACAGGGG + Intronic
1013160839 6:107543194-107543216 AGGTTGATTCAGCAGCACAGTGG + Intronic
1022301724 7:29108091-29108113 AGGTTGCCCCAGCACCTCACGGG + Intronic
1022483686 7:30761042-30761064 AGGTTACTTCAGGACCACAGGGG - Intronic
1024565559 7:50677039-50677061 AGGTTGCCTTAGAAAAACAGGGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1031950846 7:127890526-127890548 AGGAGCCCTCAGCAATACAGTGG + Intronic
1033250345 7:139753201-139753223 AGGCTGCCTCCGCAGAACAGAGG + Intronic
1036079259 8:5536128-5536150 GGATTGCTTCAGCACTTCAGAGG - Intergenic
1041960175 8:63605731-63605753 AGGGCGCCTCAGAACTGCAGTGG + Intergenic
1047632228 8:126720963-126720985 TGGCTGCTTCAGCACTACAATGG + Intergenic
1049399230 8:142417455-142417477 AGGTTGGCACAGCTCTGCAGGGG + Intergenic
1056795175 9:89654148-89654170 CGGCTGCCTCAGCTCTGCAGGGG + Intergenic
1202795237 9_KI270719v1_random:114915-114937 ATGTGGCCTCAGCTCTAGAGAGG - Intergenic
1188170410 X:26917920-26917942 AGGTTCCCTGAGCAGGACAGTGG - Intergenic
1191218483 X:57959315-57959337 AAGTTGTCTCAGCACTAGAGAGG + Intergenic
1193686871 X:84587490-84587512 ATGTTGCCTAAACACTAGAGAGG - Intergenic
1201542579 Y:15123356-15123378 AGTTTGCCTGTGCACTATAGGGG + Intergenic
1202329082 Y:23726661-23726683 AGGTGGCCTCACCACAGCAGAGG + Intergenic
1202541689 Y:25943393-25943415 AGGTGGCCTCACCACAGCAGAGG - Intergenic