ID: 959685274

View in Genome Browser
Species Human (GRCh38)
Location 3:109139275-109139297
Sequence GCCTCTACCACTTTTTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959685274_959685276 14 Left 959685274 3:109139275-109139297 CCTCTTGAAAAAGTGGTAGAGGC No data
Right 959685276 3:109139312-109139334 TGCTTCCATAAGAAACAACCAGG No data
959685274_959685279 29 Left 959685274 3:109139275-109139297 CCTCTTGAAAAAGTGGTAGAGGC No data
Right 959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG No data
959685274_959685278 28 Left 959685274 3:109139275-109139297 CCTCTTGAAAAAGTGGTAGAGGC No data
Right 959685278 3:109139326-109139348 ACAACCAGGAGTTAAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959685274 Original CRISPR GCCTCTACCACTTTTTCAAG AGG (reversed) Intergenic
No off target data available for this crispr