ID: 959685275

View in Genome Browser
Species Human (GRCh38)
Location 3:109139308-109139330
Sequence GTTGTTTCTTATGGAAGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959685275_959685279 -4 Left 959685275 3:109139308-109139330 CCGTTGCTTCCATAAGAAACAAC No data
Right 959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG No data
959685275_959685283 29 Left 959685275 3:109139308-109139330 CCGTTGCTTCCATAAGAAACAAC No data
Right 959685283 3:109139360-109139382 TGACAAAATTGAGCAGAACCAGG No data
959685275_959685278 -5 Left 959685275 3:109139308-109139330 CCGTTGCTTCCATAAGAAACAAC No data
Right 959685278 3:109139326-109139348 ACAACCAGGAGTTAAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959685275 Original CRISPR GTTGTTTCTTATGGAAGCAA CGG (reversed) Intergenic
No off target data available for this crispr