ID: 959685279

View in Genome Browser
Species Human (GRCh38)
Location 3:109139327-109139349
Sequence CAACCAGGAGTTAAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959685275_959685279 -4 Left 959685275 3:109139308-109139330 CCGTTGCTTCCATAAGAAACAAC No data
Right 959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG No data
959685274_959685279 29 Left 959685274 3:109139275-109139297 CCTCTTGAAAAAGTGGTAGAGGC No data
Right 959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959685279 Original CRISPR CAACCAGGAGTTAAGAAGCT GGG Intergenic
No off target data available for this crispr