ID: 959687152

View in Genome Browser
Species Human (GRCh38)
Location 3:109159870-109159892
Sequence TTCTACCAGCAGTCACTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959687152_959687154 23 Left 959687152 3:109159870-109159892 CCCTAGAGTGACTGCTGGTAGAA No data
Right 959687154 3:109159916-109159938 ATAAACTAAATTTTTATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959687152 Original CRISPR TTCTACCAGCAGTCACTCTA GGG (reversed) Intergenic
No off target data available for this crispr