ID: 959689138

View in Genome Browser
Species Human (GRCh38)
Location 3:109179681-109179703
Sequence AATGGCTTGGTAAAAACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959689138_959689142 20 Left 959689138 3:109179681-109179703 CCTTGAGTTTTTACCAAGCCATT No data
Right 959689142 3:109179724-109179746 ATCTTTGCATGAAGCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959689138 Original CRISPR AATGGCTTGGTAAAAACTCA AGG (reversed) Intergenic
No off target data available for this crispr