ID: 959693622

View in Genome Browser
Species Human (GRCh38)
Location 3:109225668-109225690
Sequence TGTTGATTTTTGAAAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959693622_959693624 0 Left 959693622 3:109225668-109225690 CCAGCTGCTTTCAAAAATCAACA No data
Right 959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG No data
959693622_959693623 -7 Left 959693622 3:109225668-109225690 CCAGCTGCTTTCAAAAATCAACA No data
Right 959693623 3:109225684-109225706 ATCAACAAATGATAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959693622 Original CRISPR TGTTGATTTTTGAAAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr