ID: 959693623

View in Genome Browser
Species Human (GRCh38)
Location 3:109225684-109225706
Sequence ATCAACAAATGATAAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959693619_959693623 26 Left 959693619 3:109225635-109225657 CCTTATAATTGTTTCCATTCACA No data
Right 959693623 3:109225684-109225706 ATCAACAAATGATAAGCAGAAGG No data
959693621_959693623 12 Left 959693621 3:109225649-109225671 CCATTCACATGGAACAACTCCAG No data
Right 959693623 3:109225684-109225706 ATCAACAAATGATAAGCAGAAGG No data
959693622_959693623 -7 Left 959693622 3:109225668-109225690 CCAGCTGCTTTCAAAAATCAACA No data
Right 959693623 3:109225684-109225706 ATCAACAAATGATAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959693623 Original CRISPR ATCAACAAATGATAAGCAGA AGG Intergenic
No off target data available for this crispr